Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G07650 95 / 3e-24 Leucine-rich repeat transmembrane protein kinase (.1.2) AT1G29720 59 / 2e-11 Leucine-rich repeat transmembrane protein kinase (.1) AT1G29730 55 / 5e-10 Leucine-rich repeat transmembrane protein kinase (.1) AT1G53430 47 / 2e-07 Leucine-rich repeat transmembrane protein kinase (.1.2) AT1G56130 46 / 4e-07 Leucine-rich repeat transmembrane protein kinase (.1) AT1G53440 46 / 5e-07 Leucine-rich repeat transmembrane protein kinase (.1) AT1G56140 46 / 7e-07 Leucine-rich repeat transmembrane protein kinase (.1) AT1G56120 44 / 2e-06 Leucine-rich repeat transmembrane protein kinase (.1) AT1G29750 44 / 3e-06 RKF1 receptor-like kinase in flowers 1 (.1.2) AT1G29740 42 / 9e-06 Leucine-rich repeat transmembrane protein kinase (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031374 [exp] 194 / 9e-59 AT1G07650 1221 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1.2) Lus10005418 [exp] 59 / 1e-11 AT1G29750 800 / 0.0 receptor-like kinase in flowers 1 (.1.2) Lus10015239 [exp] 58 / 3e-11 AT1G29750 1189 / 0.0 receptor-like kinase in flowers 1 (.1.2) Lus10031199 [exp] 49 / 8e-08 AT1G56130 1261 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Lus10042505 [exp] 45 / 2e-06 AT1G53440 1013 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Lus10041937 [exp] 44 / 5e-06 AT1G53440 1138 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Lus10005550 [exp] 44 / 6e-06 AT1G53440 1223 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Lus10031777 [exp] 41 / 2e-05 AT1G56140 189 / 1e-55 Leucine-rich repeat transmembrane protein kinase (.1) Lus10028149 [exp] 40 / 6e-05 AT1G16670 434 / 6e-152 Protein kinase superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G135500 [exp] 129 / 3e-36 AT1G07650 1324 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1.2) Potri.T013544 [exp] 78 / 2e-19 AT1G07650 115 / 6e-30 Leucine-rich repeat transmembrane protein kinase (.1.2) Potri.011G072741 [exp] 69 / 4e-15 AT1G29740 1014 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Potri.011G073191 [exp] 68 / 6e-15 AT1G07650 370 / 1e-120 Leucine-rich repeat transmembrane protein kinase (.1.2) Potri.011G073466 [exp] 68 / 9e-15 AT1G29740 1018 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Potri.011G073066 [exp] 68 / 9e-15 AT1G07650 488 / 1e-164 Leucine-rich repeat transmembrane protein kinase (.1.2) Potri.011G072941 [exp] 68 / 1e-14 AT1G29720 947 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Potri.011G073391 [exp] 68 / 1e-14 AT1G29730 893 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Potri.011G073241 [exp] 68 / 1e-14 AT1G29730 978 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1) Potri.011G072591 [exp] 68 / 1e-14 AT1G29730 996 / 0.0 Leucine-rich repeat transmembrane protein kinase (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10010950 pacid=23172474 polypeptide=Lus10010950 locus=Lus10010950.g ID=Lus10010950.BGIv1.0 annot-version=v1.0 ATGGCTCCTGCTCTCTTGTGCACCAATGCATCGCCGAGTCTCCGGCCAACCATGTCCCAAGCGGTGAGTATGTTAGAAGGCCGAACCGCAATCCAAGACC TACTATCTGACCCTGGTTACTCCGCGAATAGAGCAAAGTACAAGGCCATAAGGAATCACTTCTGGCAGAACCCAAGTAGGACTCAAAGCATGTCGACAGA TGATGGATATACGGATTACTCGAGCCGGCATCCAGAGGTAGAAGAATCTGGGAGCTTGTTAAGAGCAGTGTCGTCGAAGACTGAGGACTAG
AA sequence Show only first row Show all	>Lus10010950 pacid=23172474 polypeptide=Lus10010950 locus=Lus10010950.g ID=Lus10010950.BGIv1.0 annot-version=v1.0 MAPALLCTNASPSLRPTMSQAVSMLEGRTAIQDLLSDPGYSANRAKYKAIRNHFWQNPSRTQSMSTDDGYTDYSSRHPEVEESGSLLRAVSSKTED

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G07650			Leucine-rich repeat transmembr...		Lus10010950 [exp]	0	1
AT4G12760			unknown protein		Lus10001181 [exp]	2.8	0.9228
AT4G39952			Pentatricopeptide repeat (PPR)...		Lus10010688 [exp]	3.2	0.9204
AT5G36930			Disease resistance protein (TI...		Lus10033825 [exp]	11.0	0.8838
AT4G01710		ARPC5, CRK	CROOKED, ARP2/3 complex 16 kDa...		Lus10042895 [exp]	11.5	0.8953
AT3G26850			histone-lysine N-methyltransfe...		Lus10002082 [exp]	16.2	0.8915
AT3G49640			Aldolase-type TIM barrel famil...		Lus10003486 [exp]	17.1	0.9057
					Lus10022017 [exp]	17.3	0.8996
AT5G27830			unknown protein		Lus10020660 [exp]	17.7	0.8819
AT1G14740			Protein of unknown function (D...		Lus10030769 [exp]	18.3	0.9026
AT2G01350		QPT	quinolinate phoshoribosyltrans...		Lus10018781 [exp]	19.5	0.8913

Compare expression of checked genes

Lus10010950 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.