Lus10011314 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10011314 pacid=23149941 polypeptide=Lus10011314 locus=Lus10011314.g ID=Lus10011314.BGIv1.0 annot-version=v1.0
ATGCTGCAGGAGGCGAACGATGAGCTGGTGAAAGTGCAACTTCAAGGATATGAAGCGATGCTTAGATCGAGGTGCATGAACTTGCAGGGTGAGGATGCAT
CAATCTACGAAGTGACCTTTAATGCCCGTGAAGCGATGATGGCGGAGAAGCGAAAGGTGGAAGCTCAAGGAGTCGAGCTTGATGCTTGCGTTGAAGGAGT
TAGACTGAAGAGAAGGAAAACCAATGGCAAGGGGCGAGCTTCAGTAATGCCAGAGACAGAGGCTTCAGAAGTAAAGCCGGATACTGCAGTCGTCCTGAAT
TAA
AA sequence
>Lus10011314 pacid=23149941 polypeptide=Lus10011314 locus=Lus10011314.g ID=Lus10011314.BGIv1.0 annot-version=v1.0
MLQEANDELVKVQLQGYEAMLRSRCMNLQGEDASIYEVTFNAREAMMAEKRKVEAQGVELDACVEGVRLKRRKTNGKGRASVMPETEASEVKPDTAVVLN

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10011314 0 1
AT4G33920 Protein phosphatase 2C family ... Lus10000700 3.7 0.9763
AT1G66950 ABCG39, PDR11, ... ATP-binding cassette G39, plei... Lus10006277 5.3 0.9763
AT2G29670 Tetratricopeptide repeat (TPR)... Lus10025981 6.5 0.9763
AT5G51740 Peptidase family M48 family pr... Lus10032437 7.5 0.9763
AT2G18660 AtPNP-A, PNP-A,... plant natriuretic peptide A (.... Lus10042436 8.1 0.8822
AT4G20060 EMB1895 EMBRYO DEFECTIVE 1895, ARM rep... Lus10038371 8.4 0.9763
AT4G23160 CRK8 cysteine-rich RLK (RECEPTOR-li... Lus10031577 9.2 0.9082
AT1G01450 Protein kinase superfamily pro... Lus10041113 9.2 0.9763
AT5G22460 alpha/beta-Hydrolases superfam... Lus10004882 9.9 0.9763
AT4G12320 CYP706A6 "cytochrome P450, family 706, ... Lus10032214 10.0 0.8772

Lus10011314 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.