Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G67660 143 / 2e-43 Restriction endonuclease, type II-like superfamily protein (.1.2.3) AT1G13810 71 / 9e-16 Restriction endonuclease, type II-like superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10006437 [exp] 204 / 9e-70 AT1G67660 172 / 8e-55 Restriction endonuclease, type II-like superfamily protein (.1.2.3) Lus10012108 [exp] 80 / 2e-20 AT1G13810 113 / 2e-31 Restriction endonuclease, type II-like superfamily protein (.1) Lus10010434 [exp] 81 / 5e-19 AT1G13810 216 / 5e-68 Restriction endonuclease, type II-like superfamily protein (.1) Lus10017632 [exp] 80 / 5e-19 AT1G13810 216 / 6e-69 Restriction endonuclease, type II-like superfamily protein (.1) Lus10033589 [exp] 58 / 9e-11 AT1G13810 161 / 4e-45 Restriction endonuclease, type II-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G054800 [exp] 166 / 2e-51 AT1G67660 391 / 7e-136 Restriction endonuclease, type II-like superfamily protein (.1.2.3) Potri.010G222500 [exp] 80 / 7e-19 AT1G13810 242 / 1e-78 Restriction endonuclease, type II-like superfamily protein (.1) Potri.008G039800 [exp] 60 / 2e-12 AT1G13810 143 / 2e-42 Restriction endonuclease, type II-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10011377 pacid=23159193 polypeptide=Lus10011377 locus=Lus10011377.g ID=Lus10011377.BGIv1.0 annot-version=v1.0 ATGCCCTTCTACTACATGCCTCAGGTTCAAGGCCAGCTCGAGATCATGGATCGGGAATGGGCGGATCTGTACTGCTGGACTCCGAATGGGAGCACGATTT TTCGCGTTCCGAGGGATCCGGGTTACTGGAATATTATAAGCAAGATACTGGAGGATTTCTGGTGGGGGAATGTGATTCCTGCTAGGGAAGCTCTCTTGGC TGGGAAAGAAGAAGAAGCCAAGTCTTTTATGCCGACTTCGACTCACAATCGCACCGGGCTCGCCATTTCCAGGAGCATTAAGTTGGCTGCTGAGTGCAAG CTTCAGTGTCGAGAGATTGCCGGACTTGTCGAATTCTTCACGTGA
AA sequence Show only first row Show all	>Lus10011377 pacid=23159193 polypeptide=Lus10011377 locus=Lus10011377.g ID=Lus10011377.BGIv1.0 annot-version=v1.0 MPFYYMPQVQGQLEIMDREWADLYCWTPNGSTIFRVPRDPGYWNIISKILEDFWWGNVIPAREALLAGKEEEAKSFMPTSTHNRTGLAISRSIKLAAECK LQCREIAGLVEFFT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G67660			Restriction endonuclease, type...		Lus10011377 [exp]	0	1
AT1G67660			Restriction endonuclease, type...		Lus10006437 [exp]	1.0	0.8777
AT3G52380		CP33, PDE322	PIGMENT DEFECTIVE 322, chlorop...		Lus10029372 [exp]	3.7	0.8490
AT3G11670		DGD1	DIGALACTOSYL DIACYLGLYCEROL DE...		Lus10029404 [exp]	4.8	0.7964
AT4G37920			unknown protein		Lus10029560 [exp]	6.0	0.8250
AT5G50250		CP31B	chloroplast RNA-binding protei...		Lus10041952 [exp]	6.3	0.8427
AT2G06510		ATRPA70A, ATRPA...	ARABIDOPSIS THALIANA RPA70-KDA...		Lus10033435 [exp]	10.1	0.7386
AT2G33180			unknown protein		Lus10011764 [exp]	13.0	0.8177
AT5G50250		CP31B	chloroplast RNA-binding protei...		Lus10017962 [exp]	13.6	0.8430
AT1G11430			plastid developmental protein ...		Lus10007615 [exp]	14.1	0.8348
AT2G22360			DNAJ heat shock family protein...		Lus10035920 [exp]	18.0	0.7892

Compare expression of checked genes

Lus10011377 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.