Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G80230 148 / 5e-47 Rubredoxin-like superfamily protein (.1) AT3G15640 131 / 2e-40 Rubredoxin-like superfamily protein (.1.2) AT1G52710 103 / 2e-30 Rubredoxin-like superfamily protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10035917 [exp] 180 / 1e-59 AT1G80230 187 / 2e-61 Rubredoxin-like superfamily protein (.1) Lus10025745 [exp] 122 / 7e-37 AT1G80230 161 / 3e-51 Rubredoxin-like superfamily protein (.1) Lus10023135 [exp] 79 / 2e-20 AT1G80230 90 / 9e-24 Rubredoxin-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G060100 [exp] 139 / 2e-43 AT1G80230 167 / 2e-53 Rubredoxin-like superfamily protein (.1) Potri.001G173800 [exp] 135 / 3e-42 AT1G80230 162 / 2e-51 Rubredoxin-like superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0045 [flax] [poplar] Rubredoxin PF01215 [flax] [poplar] COX5B Cytochrome c oxidase subunit Vb
Representative CDS sequence Show only first row Show all	>Lus10011494 pacid=23182634 polypeptide=Lus10011494 locus=Lus10011494.g ID=Lus10011494.BGIv1.0 annot-version=v1.0 ATGCCTATTGCCACTGGACATGAACGTGAAGAACTTGAAGCTGAGTTGCAGGGAAAGGATATCCTTGACATGAACTTCCCCGTCGGTCCATTTGGCACAA AGGAAGAACCTGCTGTTGTCAAGTCCTATTATGATAGGAGGATAGTTGGATGCCCCGGAGGTGAAGAAGAGGATGAACATGATGTTGTCTGGTTTTGGTT GGAAAAGGGCAAGCCTGCTGAATGCCCTGTCTGCGCACAGTACTTTGTGCTGGAGGTTGAGGGCCCTGGAGGAGACTGGGAAGCTGGACATGGTGATCAC TAA
AA sequence Show only first row Show all	>Lus10011494 pacid=23182634 polypeptide=Lus10011494 locus=Lus10011494.g ID=Lus10011494.BGIv1.0 annot-version=v1.0 MPIATGHEREELEAELQGKDILDMNFPVGPFGTKEEPAVVKSYYDRRIVGCPGGEEEDEHDVVWFWLEKGKPAECPVCAQYFVLEVEGPGGDWEAGHGDH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G80230			Rubredoxin-like superfamily pr...		Lus10011494 [exp]	0	1
AT5G40810			Cytochrome C1 family (.1.2)		Lus10022327 [exp]	3.5	0.8872
AT5G40810			Cytochrome C1 family (.1.2)		Lus10022328 [exp]	7.1	0.8283
AT5G58590		RANBP1	RAN binding protein 1 (.1)		Lus10035655 [exp]	11.0	0.8455
AT2G33040		ATP3	gamma subunit of Mt ATP syntha...		Lus10007534 [exp]	13.4	0.8487
AT5G13430			Ubiquinol-cytochrome C reducta...		Lus10031982 [exp]	13.6	0.8409
AT4G10040		CYTC-2	cytochrome c-2 (.1)		Lus10028892 [exp]	16.6	0.8639
AT4G33410		ATSPPL1	SIGNAL PEPTIDE PEPTIDASE-LIKE ...		Lus10027484 [exp]	20.1	0.8350
AT1G77670			Pyridoxal phosphate (PLP)-depe...		Lus10004089 [exp]	26.5	0.8286
AT4G10040		CYTC-2	cytochrome c-2 (.1)		Lus10008922 [exp]	26.5	0.8204
AT5G50850		MAB1	MACCI-BOU, Transketolase famil...		Lus10043191 [exp]	27.2	0.8100

Compare expression of checked genes

Lus10011494 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.