Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G22380 112 / 2e-30 ATUGT85A3 UDP-glucosyl transferase 85A3 (.1) AT1G78270 109 / 2e-29 ATUGT85A4 UDP-glucosyl transferase 85A4 (.1) AT1G22400 108 / 6e-29 ATUGT85A1, UGT85A1 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) AT1G22340 107 / 1e-28 ATUGT85A7 UDP-glucosyl transferase 85A7 (.1) AT1G22360 100 / 5e-26 ATUGT85A2, AT2 UDP-glucosyl transferase 85A2 (.1.2) AT1G22370 95 / 1e-24 ATUGT85A5 UDP-glucosyl transferase 85A5 (.1.2) AT2G36970 68 / 2e-14 UDP-Glycosyltransferase superfamily protein (.1) AT3G46660 67 / 3e-14 UGT76E12 UDP-glucosyl transferase 76E12 (.1) AT3G46670 66 / 6e-14 UGT76E11 UDP-glucosyl transferase 76E11 (.1) AT5G59590 66 / 7e-14 UGT76E2 UDP-glucosyl transferase 76E2 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010665 [exp] 172 / 7e-53 AT1G22400 516 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10017542 [exp] 135 / 8e-39 AT1G22400 499 / 4e-174 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10007421 [exp] 133 / 6e-38 AT1G22400 529 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10019364 [exp] 132 / 7e-38 AT1G22400 523 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10024583 [exp] 104 / 2e-27 AT1G22380 598 / 0.0 UDP-glucosyl transferase 85A3 (.1) Lus10013919 [exp] 100 / 5e-27 AT1G22380 318 / 2e-106 UDP-glucosyl transferase 85A3 (.1) Lus10025741 [exp] 103 / 6e-27 AT1G22380 525 / 0.0 UDP-glucosyl transferase 85A3 (.1) Lus10013653 [exp] 94 / 7e-27 AT1G22360 69 / 9e-16 UDP-glucosyl transferase 85A2 (.1.2) Lus10013923 [exp] 101 / 3e-26 AT1G22400 537 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G020400 [exp] 123 / 2e-34 AT1G22340 483 / 4e-168 UDP-glucosyl transferase 85A7 (.1) Potri.007G132400 [exp] 121 / 1e-33 AT1G22340 527 / 0.0 UDP-glucosyl transferase 85A7 (.1) Potri.006G023151 [exp] 118 / 1e-32 AT1G22400 521 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Potri.006G023700 [exp] 117 / 2e-32 AT1G22370 476 / 2e-165 UDP-glucosyl transferase 85A5 (.1.2) Potri.016G022000 [exp] 116 / 6e-32 AT1G22360 499 / 1e-174 UDP-glucosyl transferase 85A2 (.1.2) Potri.016G022400 [exp] 115 / 1e-31 AT1G22360 495 / 4e-173 UDP-glucosyl transferase 85A2 (.1.2) Potri.016G022100 [exp] 115 / 1e-31 AT1G22380 489 / 2e-170 UDP-glucosyl transferase 85A3 (.1) Potri.016G021000 [exp] 115 / 1e-31 AT1G22360 561 / 0.0 UDP-glucosyl transferase 85A2 (.1.2) Potri.017G052000 [exp] 115 / 2e-31 AT1G22360 617 / 0.0 UDP-glucosyl transferase 85A2 (.1.2) Potri.004G172700 [exp] 115 / 2e-31 AT1G22370 465 / 3e-161 UDP-glucosyl transferase 85A5 (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0113 [flax] [poplar] GT-B PF00201 [flax] [poplar] UDPGT UDP-glucoronosyl and UDP-glucosyl transferase
Representative CDS sequence Show only first row Show all	>Lus10011662 pacid=23149663 polypeptide=Lus10011662 locus=Lus10011662.g ID=Lus10011662.BGIv1.0 annot-version=v1.0 ATGCACTGCAGGTGGGGTTCGACGATTGAGACGCTGAGTGCTGGAGTTTCGTTGTTGTACTGGCCGTTCTTCGCAGACCAGCAGACCAACTATAAGTTTT TTTGTAAGGATTGGGGAATAGGAATGGAGATTGAGAAAGATGTGAATAGGAATGTGTTGGAGGAACTAGTGAGGGAGCGGATGAAGGGGGACAATGGTGA CAAGATGAGGAACAAGGCTCGGGATTGGGAGAGATCAGTGAGAGAAGCTACAGAGTTTGAAGGTGCATCTACAGTCAAATTTGATCGAGTGATTAATGAA GTGGTTTTCAAAAAAAGGAGATGA
AA sequence Show only first row Show all	>Lus10011662 pacid=23149663 polypeptide=Lus10011662 locus=Lus10011662.g ID=Lus10011662.BGIv1.0 annot-version=v1.0 MHCRWGSTIETLSAGVSLLYWPFFADQQTNYKFFCKDWGIGMEIEKDVNRNVLEELVRERMKGDNGDKMRNKARDWERSVREATEFEGASTVKFDRVINE VVFKKRR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G22340		ATUGT85A7	UDP-glucosyl transferase 85A7 ...		Lus10011662 [exp]	0	1
AT4G31880			unknown protein		Lus10002307 [exp]	1.0	0.9811
AT5G67360		ARA12	Subtilase family protein (.1)		Lus10006310 [exp]	6.2	0.9363
AT1G74670		GASA6	GA-stimulated Arabidopsis 6, G...		Lus10024216 [exp]	7.6	0.9546
AT4G14590		EMB2739	embryo defective 2739 (.1)		Lus10009705 [exp]	7.7	0.9140
AT3G24490	Trihelix		Alcohol dehydrogenase transcri...		Lus10014730 [exp]	9.2	0.8823
					Lus10023587 [exp]	9.3	0.9546
AT2G25470		AtRLP21	receptor like protein 21 (.1)		Lus10027855 [exp]	10.8	0.9546
AT1G06330			Heavy metal transport/detoxifi...		Lus10028331 [exp]	11.6	0.8686
AT3G19540			Protein of unknown function (D...		Lus10028040 [exp]	12.0	0.9546
AT4G38380			MATE efflux family protein (.1...		Lus10023944 [exp]	12.0	0.8914

Compare expression of checked genes

Lus10011662 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.