Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G57990 115 / 1e-31 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10016269 [exp] 208 / 4e-71 ND 169 / 1e-52 Lus10012013 [exp] 212 / 3e-69 AT3G57990 296 / 3e-98 unknown protein Lus10016270 [exp] 200 / 1e-64 AT3G57990 300 / 4e-100 unknown protein Lus10021042 [exp] 140 / 3e-41 AT3G57990 341 / 6e-116 unknown protein Lus10004184 [exp] 140 / 4e-41 AT3G57990 329 / 3e-111 unknown protein Lus10000401 [exp] 115 / 4e-34 AT3G57990 107 / 4e-29 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G191800 [exp] 115 / 8e-32 AT3G57990 299 / 1e-99 unknown protein Potri.016G046900 [exp] 108 / 1e-29 AT3G57990 345 / 3e-118 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10012012 pacid=23161428 polypeptide=Lus10012012 locus=Lus10012012.g ID=Lus10012012.BGIv1.0 annot-version=v1.0 ATGAACCTAGGGTTTCCGTTTCCGTTCCCGATCAAATTGAACTCGGCGCTCATCACGAACGGGCTGGAGATCGGAGATCCGAAATCCCCCGTCCCTGTCT TGACCACTAGCGAGAACGGATTCCGTGAATCGTTGGGGCGGTACGAGACCTTGAGCGACGGGCCGGAATCGAAGTACGTCGAGAGGTTGAGGGAGAGCTC CTTGGAGTCTCCGGCGACGATCCCGGACTGGAATGGGAAGCCGAGGATGTTGAGAGGGATCTTCCCCCTGAACAGCGGCGGGTTCTGCTCGTCTCGGAAT TTGAGCGAGGCTTTCATCTCTGTTTCTGCTCTTAATGAAGAAGATGAAGAAGAAGAATCATTCGGTGAAAATGGAGAGTGA
AA sequence Show only first row Show all	>Lus10012012 pacid=23161428 polypeptide=Lus10012012 locus=Lus10012012.g ID=Lus10012012.BGIv1.0 annot-version=v1.0 MNLGFPFPFPIKLNSALITNGLEIGDPKSPVPVLTTSENGFRESLGRYETLSDGPESKYVERLRESSLESPATIPDWNGKPRMLRGIFPLNSGGFCSSRN LSEAFISVSALNEEDEEEESFGENGE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10012012 [exp]	0	1
					Lus10038255 [exp]	1.4	0.9090
AT5G41610		ATCHX18	cation/H+ exchanger 18, ARABID...		Lus10017541 [exp]	1.4	0.8674
					Lus10016269 [exp]	2.8	0.8620
					Lus10026090 [exp]	3.5	0.7846
AT5G39210		CRR7	chlororespiratory reduction 7 ...		Lus10032982 [exp]	3.9	0.8622
AT2G02470	Alfin	AL6	alfin-like 6 (.1.2)		Lus10042404 [exp]	4.9	0.8211
AT4G16480		ATINT4	inositol transporter 4 (.1)		Lus10039050 [exp]	6.2	0.7671
AT4G26240			unknown protein		Lus10012919 [exp]	6.7	0.7971
AT3G16175			Thioesterase superfamily prote...		Lus10006834 [exp]	6.9	0.7699
					Lus10027007 [exp]	7.2	0.7596

Compare expression of checked genes

Lus10012012 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.