Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G33355 65 / 1e-14 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) AT3G51590 59 / 5e-12 LTP12 lipid transfer protein 12 (.1) AT3G51600 56 / 4e-11 LTP5 lipid transfer protein 5 (.1) AT2G38530 56 / 4e-11 cdf3, LP2, LTP2 cell growth defect factor-3, lipid transfer protein 2 (.1) AT5G59320 55 / 1e-10 LTP3 lipid transfer protein 3 (.1) AT5G59310 55 / 1e-10 LTP4 lipid transfer protein 4 (.1) AT3G08770 55 / 1e-10 LTP6 lipid transfer protein 6 (.1.2) AT2G18370 53 / 8e-10 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT2G15325 51 / 5e-09 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT2G38540 48 / 8e-08 ATLTP1, LP1 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10029445 [exp] 69 / 5e-16 AT4G33355 103 / 2e-29 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10040917 [exp] 72 / 1e-15 AT4G01030 898 / 0.0 pentatricopeptide (PPR) repeat-containing protein (.1) Lus10001703 [exp] 66 / 6e-15 AT4G33355 86 / 9e-23 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10007280 [exp] 63 / 2e-13 AT5G59310 90 / 2e-24 lipid transfer protein 4 (.1) Lus10029226 [exp] 62 / 3e-13 AT5G59310 94 / 3e-26 lipid transfer protein 4 (.1) Lus10033667 [exp] 61 / 1e-12 AT5G44265 52 / 2e-09 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Lus10015279 [exp] 60 / 2e-12 AT5G59320 116 / 6e-35 lipid transfer protein 3 (.1) Lus10017710 [exp] 59 / 6e-12 AT5G44265 54 / 8e-10 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Lus10005156 [exp] 61 / 1e-11 AT3G55400 931 / 0.0 OVULE ABORTION 1, methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS) (.1), methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G135700 [exp] 62 / 2e-13 AT5G59310 92 / 3e-25 lipid transfer protein 4 (.1) Potri.014G046500 [exp] 61 / 5e-13 AT4G33355 76 / 6e-19 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Potri.011G021900 [exp] 57 / 2e-11 AT3G08770 60 / 8e-13 lipid transfer protein 6 (.1.2) Potri.001G232900 [exp] 56 / 8e-11 AT2G18370 100 / 3e-28 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135500 [exp] 56 / 9e-11 AT5G59320 94 / 8e-26 lipid transfer protein 3 (.1) Potri.001G232700 [exp] 55 / 2e-10 AT2G18370 93 / 1e-25 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.017G013200 [exp] 52 / 1e-09 AT5G44265 106 / 1e-30 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135800 [exp] 52 / 2e-09 AT5G01870 111 / 1e-32 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.009G025200 [exp] 51 / 3e-09 AT2G18370 86 / 6e-23 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135400 [exp] 50 / 9e-09 AT5G59320 109 / 3e-32 lipid transfer protein 3 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0482 [flax] [poplar] Prolamin PF00234 [flax] [poplar] Tryp_alpha_amyl Protease inhibitor/seed storage/LTP family
Representative CDS sequence Show only first row Show all	>Lus10012392 pacid=23147306 polypeptide=Lus10012392 locus=Lus10012392.g ID=Lus10012392.BGIv1.0 annot-version=v1.0 ATGAAGTCCCTGCCGATCATACTCGCCGCAACAATTGCCATGACAGCGGCCATCACAATTTCCGCTTCTACAGCTGTGCCCTGCGACCAGGTGGTGCGGA CGCTAATACCCTGTCTCCCATACCTAACAGCCGTCGGGACTACTCCGTCGACCGGGTGTTGTGACGCAGTGACGAGCTTAAAAAAGATGGCGGAGAAGTC ACCAGAGGATAAACGGGCTACTTGTGAGTGCGTGAAGGAAGCTGTAATCAGGTCCCAACAGAGGATTAAGACGGAGGTTGCATCCCACCTGCCTAAACTA TGTTCCGTGGATGTCACCGTTCCCATTTCCAAAGACGTAGATTGCAGCAAGCTTTCTGCTACTGCACCTGGAAAACTGCGACTTGGAAATTAA
AA sequence Show only first row Show all	>Lus10012392 pacid=23147306 polypeptide=Lus10012392 locus=Lus10012392.g ID=Lus10012392.BGIv1.0 annot-version=v1.0 MKSLPIILAATIAMTAAITISASTAVPCDQVVRTLIPCLPYLTAVGTTPSTGCCDAVTSLKKMAEKSPEDKRATCECVKEAVIRSQQRIKTEVASHLPKL CSVDVTVPISKDVDCSKLSATAPGKLRLGN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G33355			Bifunctional inhibitor/lipid-t...		Lus10012392 [exp]	0	1

Compare expression of checked genes

Lus10012392 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.