Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G25570 63 / 5e-15 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007669 [exp] 108 / 9e-33 AT5G25570 76 / 8e-19 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G245100 [exp] 73 / 8e-19 AT5G25570 68 / 4e-16 unknown protein Potri.012G125000 [exp] 69 / 3e-17 AT5G25570 67 / 1e-15 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10012419 pacid=23160968 polypeptide=Lus10012419 locus=Lus10012419.g ID=Lus10012419.BGIv1.0 annot-version=v1.0 ATGGGGGACATGCTTAAGATGACAAGTGAAATCGATCAGAATATTGTCGAAGTAATGGTGGAGATGGGGAAATGCAAAGAGTTCGCTACGGAGAGGAAGA AAGCTCTGGATGAAGAGAAAGAAAAGTTTCAAAAGGCTGCTTATGCCGTTCTAGAGATGCTTGGCGGCTAA
AA sequence Show only first row Show all	>Lus10012419 pacid=23160968 polypeptide=Lus10012419 locus=Lus10012419.g ID=Lus10012419.BGIv1.0 annot-version=v1.0 MGDMLKMTSEIDQNIVEVMVEMGKCKEFATERKKALDEEKEKFQKAAYAVLEMLGG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G25570			unknown protein		Lus10012419 [exp]	0	1
AT3G24140	bHLH	bHLH097, FMA	FAMA, basic helix-loop-helix (...		Lus10016680 [exp]	12.9	0.7056
AT1G47840		HXK3	hexokinase 3 (.1)		Lus10037367 [exp]	13.8	0.6803
AT2G46760			D-arabinono-1,4-lactone oxidas...		Lus10002688 [exp]	19.4	0.6897
AT3G29590		AT5MAT	HXXXD-type acyl-transferase fa...		Lus10021389 [exp]	28.8	0.6726
AT4G36250		ALDH3F1	aldehyde dehydrogenase 3F1 (.1...		Lus10041806 [exp]	29.2	0.6861
AT1G67730		ATKCR1, YBR159,...	beta-ketoacyl reductase 1 (.1)		Lus10006248 [exp]	40.9	0.6611
AT4G14480			Protein kinase superfamily pro...		Lus10021882 [exp]	41.7	0.6635
AT1G68530		KCS6, CER6, POP...	POLLEN-PISTIL INCOMPATIBILITY ...		Lus10034319 [exp]	49.6	0.6704
AT4G38840			SAUR-like auxin-responsive pro...		Lus10010713 [exp]	55.2	0.6460
AT1G25450		KCS5, CER60	ECERIFERUM 60, 3-ketoacyl-CoA ...		Lus10041452 [exp]	60.8	0.6561

Compare expression of checked genes

Lus10012419 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.