Lus10012573 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G26790 88 / 8e-22 B3 FUS3 FUSCA 3, AP2/B3-like transcriptional factor family protein (.1)
AT3G24650 66 / 1e-13 B3 SIS10, ABI3 SUGAR INSENSITIVE 10, ABSCISIC ACID INSENSITIVE 3, ABA INSENSITIVE 3, AP2/B3-like transcriptional factor family protein (.1)
AT2G30470 60 / 2e-11 B3 HSI2, VAL1 VP1/ABI3-LIKE 1, high-level expression of sugar-inducible gene 2 (.1)
AT1G28300 58 / 1e-10 B3 LEC2 LEAFY COTYLEDON 2, AP2/B3-like transcriptional factor family protein (.1)
AT4G32010 55 / 2e-09 B3 HSL1, HSI2-L1, VAL2 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
AT4G21550 45 / 4e-06 B3 HSI2-L2, VAL3 VP1/ABI3-like 3 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10041521 103 / 2e-27 AT3G26790 255 / 1e-83 FUSCA 3, AP2/B3-like transcriptional factor family protein (.1)
Lus10012572 102 / 3e-27 AT3G26790 259 / 4e-85 FUSCA 3, AP2/B3-like transcriptional factor family protein (.1)
Lus10022820 67 / 6e-14 AT3G24650 313 / 1e-100 SUGAR INSENSITIVE 10, ABSCISIC ACID INSENSITIVE 3, ABA INSENSITIVE 3, AP2/B3-like transcriptional factor family protein (.1)
Lus10011888 62 / 3e-12 AT3G24650 312 / 6e-96 SUGAR INSENSITIVE 10, ABSCISIC ACID INSENSITIVE 3, ABA INSENSITIVE 3, AP2/B3-like transcriptional factor family protein (.1)
Lus10011245 61 / 1e-11 AT2G30470 399 / 1e-122 VP1/ABI3-LIKE 1, high-level expression of sugar-inducible gene 2 (.1)
Lus10018440 58 / 2e-10 AT4G32010 487 / 1e-158 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Lus10025142 56 / 9e-10 AT4G32010 794 / 0.0 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Lus10025226 55 / 2e-09 AT4G32010 808 / 0.0 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Lus10022741 55 / 2e-09 AT4G32010 748 / 0.0 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.001G322700 89 / 4e-22 AT3G26790 279 / 3e-93 FUSCA 3, AP2/B3-like transcriptional factor family protein (.1)
Potri.017G061200 86 / 4e-21 AT3G26790 288 / 8e-97 FUSCA 3, AP2/B3-like transcriptional factor family protein (.1)
Potri.002G252000 62 / 5e-12 AT3G24650 499 / 2e-167 SUGAR INSENSITIVE 10, ABSCISIC ACID INSENSITIVE 3, ABA INSENSITIVE 3, AP2/B3-like transcriptional factor family protein (.1)
Potri.013G157500 57 / 2e-10 AT2G30470 767 / 0.0 VP1/ABI3-LIKE 1, high-level expression of sugar-inducible gene 2 (.1)
Potri.019G130300 56 / 5e-10 AT2G30470 757 / 0.0 VP1/ABI3-LIKE 1, high-level expression of sugar-inducible gene 2 (.1)
Potri.006G108300 56 / 9e-10 AT4G32010 743 / 0.0 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Potri.016G136500 56 / 9e-10 AT4G32010 789 / 0.0 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Potri.011G043600 54 / 2e-09 AT4G32010 479 / 5e-157 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Potri.004G035300 53 / 4e-09 AT4G32010 483 / 3e-158 VP1/ABI3-LIKE 2, HSI2-like 1 (.1)
Potri.004G045800 52 / 1e-08 AT1G28300 201 / 2e-60 LEAFY COTYLEDON 2, AP2/B3-like transcriptional factor family protein (.1)
PFAM info
Representative CDS sequence
>Lus10012573 pacid=23143867 polypeptide=Lus10012573 locus=Lus10012573.g ID=Lus10012573.BGIv1.0 annot-version=v1.0
ATGACGACGAGGAAACCGAGGCGTGTTGGAAGGGAACAGGTGGCCGCAACCCGACCACCGATGATGGGCGTCCATCGGGTCAGGGGGTTGACCCGGAGGC
ATCCTTCAGCTGGCCACCTCCTCCTCCTTCCATCATACTGCAGAGACACACCTGCCACAGAGACGCACCTGCCAGTACTAGAATCAAAGGAAGGGTTCCC
AATCACCATGTATGACTTGGACGGTTCCCACGTCTGGAGCTTCAAGTACAGGTATTGGCCAAATAAAAACAGCAGGATGTACGTCTTGGAGAAAACTGGG
ATGAGTACAATTGCTGGTGGTAAGGTAGATACTAGGATGTGGGTTTCAGTTTCAGGTAATACTTGCAATGACGAGATGTCTAACTAA
AA sequence
>Lus10012573 pacid=23143867 polypeptide=Lus10012573 locus=Lus10012573.g ID=Lus10012573.BGIv1.0 annot-version=v1.0
MTTRKPRRVGREQVAATRPPMMGVHRVRGLTRRHPSAGHLLLLPSYCRDTPATETHLPVLESKEGFPITMYDLDGSHVWSFKYRYWPNKNSRMYVLEKTG
MSTIAGGKVDTRMWVSVSGNTCNDEMSN

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT3G26790 B3 FUS3 FUSCA 3, AP2/B3-like transcrip... Lus10012573 0 1
AT2G03630 unknown protein Lus10029645 1.4 0.9994
AT4G38590 BGAL14 beta-galactosidase 14 (.1.2) Lus10005070 1.7 0.9841
Lus10034143 2.0 0.9994
AT5G23570 SGS3, ATSGS3 SUPPRESSOR OF GENE SILENCING 3... Lus10026697 2.8 0.9830
AT5G09550 GDP dissociation inhibitor fam... Lus10035634 3.9 0.9753
Lus10014474 5.9 0.9430
AT2G20515 unknown protein Lus10024890 17.0 0.9211
AT1G10200 LIM WLIM1, SF3 WLIM1, GATA type zinc finger t... Lus10039010 19.3 0.8735
Lus10038209 26.3 0.9459
Lus10014949 27.4 0.9355

Lus10012573 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.