Lus10012605 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G01410 67 / 3e-14 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT3G52470 47 / 6e-07 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT1G17620 47 / 1e-06 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT5G53730 44 / 6e-06 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT3G44220 42 / 2e-05 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT5G06330 41 / 7e-05 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
AT5G22200 39 / 0.0003 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10030193 71 / 1e-15 AT4G01410 185 / 3e-58 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10015622 48 / 4e-07 AT1G17620 196 / 5e-62 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10037638 47 / 1e-06 AT1G17620 201 / 4e-64 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10003824 45 / 5e-06 AT1G17620 191 / 5e-60 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10043410 44 / 8e-06 AT3G44220 207 / 6e-68 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10000157 44 / 1e-05 AT3G52470 164 / 3e-51 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10004202 43 / 2e-05 AT3G11660 257 / 8e-88 NDR1/HIN1-like 1 (.1)
Lus10021286 43 / 2e-05 AT3G52470 298 / 1e-103 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Lus10029406 42 / 6e-05 AT3G11660 252 / 7e-86 NDR1/HIN1-like 1 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G180000 70 / 2e-15 AT4G01410 232 / 9e-78 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.014G106100 70 / 2e-15 AT4G01410 185 / 7e-59 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.003G039400 49 / 2e-07 AT1G17620 208 / 1e-66 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.016G071500 47 / 4e-07 AT3G11660 272 / 1e-93 NDR1/HIN1-like 1 (.1)
Potri.006G204200 47 / 8e-07 AT3G11660 267 / 1e-91 NDR1/HIN1-like 1 (.1)
Potri.001G200700 46 / 2e-06 AT1G17620 168 / 2e-51 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.009G019600 45 / 2e-06 AT3G44220 242 / 8e-82 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.018G052500 44 / 1e-05 AT5G11890 198 / 3e-62 EMBRYO DEFECTIVE 3135, unknown protein
Potri.005G088000 43 / 2e-05 AT3G44220 194 / 5e-63 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Potri.006G228600 42 / 3e-05 AT5G11890 171 / 4e-52 EMBRYO DEFECTIVE 3135, unknown protein
PFAM info
Representative CDS sequence
>Lus10012605 pacid=23161342 polypeptide=Lus10012605 locus=Lus10012605.g ID=Lus10012605.BGIv1.0 annot-version=v1.0
ATGGCAGAACACCATTTACCACCGGAAGACGACACCTCCGACCCAAAACACACCTCACCACCGCCACGACGTCGATCATACAGCTCCTACTACGGCCACA
GCAACGTCGCCACCGCAATCACCGCCATCCTCCTAATCCTCGCCACCATCTTCCTCATCCTCTGGCTCGTCTACCGCCCCCACAAACCCACCTTCAACAT
AGCAGCTGCCGCCGTCTACTCCCTCAATGTCACTACTCCTCCTTTCCTAGCCACCGCTTTCCAGTTCACCATCGTCGCCCGCAACCCCAACCGCGCGTCT
CCATCCTCTACGACCACATCACCGCCTACGTCGTGTATCGCAACCAGCCAATCACCGTCCCGGTACCCCTGCCCCCGCTTCACCACCACACGAAGACAAC
CGTCACCCTGTCGCCTATAA
AA sequence
>Lus10012605 pacid=23161342 polypeptide=Lus10012605 locus=Lus10012605.g ID=Lus10012605.BGIv1.0 annot-version=v1.0
MAEHHLPPEDDTSDPKHTSPPPRRRSYSSYYGHSNVATAITAILLILATIFLILWLVYRPHKPTFNIAAAAVYSLNVTTPPFLATAFQFTIVARNPNRAS
PSSTTTSPPTSCIATSQSPSRYPCPRFTTTRRQPSPCRL

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G01410 Late embryogenesis abundant (L... Lus10012605 0 1
Lus10013898 4.5 0.8962
AT2G20410 RNA-binding ASCH domain protei... Lus10000855 5.8 0.7924
AT1G24764 ATMAP70-2 microtubule-associated protein... Lus10019171 6.6 0.8397
Lus10003840 9.6 0.8587
AT3G28050 nodulin MtN21 /EamA-like trans... Lus10039426 11.0 0.7761
Lus10005396 11.7 0.8587
Lus10022573 13.6 0.8587
AT1G06290 ATACX3, ACX3 acyl-CoA oxidase 3 (.1) Lus10002177 13.7 0.8471
Lus10002746 14.0 0.7614
AT2G18370 Bifunctional inhibitor/lipid-t... Lus10001431 15.2 0.8587

Lus10012605 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.