Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G65495 49 / 1e-08 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002656 [exp] 127 / 3e-39 AT5G65495 69 / 1e-16 unknown protein
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10012729 pacid=23148158 polypeptide=Lus10012729 locus=Lus10012729.g ID=Lus10012729.BGIv1.0 annot-version=v1.0 ATGTGCTGCGGACGGCAAAGCTCCTTATCTCCGAGAGATCCAATCCACCGGTCTCGCAACCGCCGATCGCCCGACGACGACGAAGCCTTGATTGAAGATC TGCGAAGTCGGCTGGCGGAGACAGAGGCGCGGCTCGAACGCGCCAGAGCTCGGGAAGCTGAGCTGACCCGACGATTGGACGAGATGAAGCGGTATCTGTC GGTGATGGAGATTCTCGAGTCGTATCTCAAGCGGCAGTTCCACGAGCAGCAAGAACGAGTCGCCTGTATATTCTCTTCCATCGCCGCCAAAGTCAAGAGC TTAAATCGGTGA
AA sequence Show only first row Show all	>Lus10012729 pacid=23148158 polypeptide=Lus10012729 locus=Lus10012729.g ID=Lus10012729.BGIv1.0 annot-version=v1.0 MCCGRQSSLSPRDPIHRSRNRRSPDDDEALIEDLRSRLAETEARLERARAREAELTRRLDEMKRYLSVMEILESYLKRQFHEQQERVACIFSSIAAKVKS LNR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G65495			unknown protein		Lus10012729 [exp]	0	1
AT5G45100		BRG1	BOI-related gene 1, SBP (S-rib...		Lus10018294 [exp]	1.4	0.9573
AT3G49390		CID10	CTC-interacting domain 10 (.1....		Lus10008851 [exp]	6.7	0.9444
AT1G13195			RING/U-box superfamily protein...		Lus10006253 [exp]	8.6	0.9548
AT1G44770			unknown protein		Lus10014131 [exp]	11.2	0.9541
AT2G42760			unknown protein		Lus10015228 [exp]	11.8	0.9366
AT4G09460	MYB	ATMYB6, ATMYB8	myb domain protein 6 (.1)		Lus10000411 [exp]	13.6	0.9365
AT4G16520		ATG8F	autophagy 8f, Ubiquitin-like s...		Lus10028933 [exp]	15.4	0.9508
AT3G04660			F-box and associated interacti...		Lus10007277 [exp]	16.5	0.9222
AT5G11680			unknown protein		Lus10020200 [exp]	17.3	0.9393
AT2G24240			BTB/POZ domain with WD40/YVTN ...		Lus10036274 [exp]	17.7	0.9456

Compare expression of checked genes

Lus10012729 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.