Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G38530 105 / 7e-29 TSBtype2 tryptophan synthase beta type 2 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10000306 [exp] 115 / 3e-32 AT5G38530 779 / 0.0 tryptophan synthase beta type 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G109600 [exp] 109 / 3e-30 AT5G38530 828 / 0.0 tryptophan synthase beta type 2 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10012746 pacid=23148163 polypeptide=Lus10012746 locus=Lus10012746.g ID=Lus10012746.BGIv1.0 annot-version=v1.0 ATGGAAGCAATCTCCATTCCTCAAACCGAGTGCTTCAAAGGTGCCATACAATTTGCTAGAAGTGAAGGGCTGATACCTGCACCAGAGCCAACTCATGCAA TCGCAGCCACCATCCGGGAAGCTCTACATTGCAGGGAGACTGGTGAAGCTAAGGTCATTCTCATGGCGATGTGA
AA sequence Show only first row Show all	>Lus10012746 pacid=23148163 polypeptide=Lus10012746 locus=Lus10012746.g ID=Lus10012746.BGIv1.0 annot-version=v1.0 MEAISIPQTECFKGAIQFARSEGLIPAPEPTHAIAATIREALHCRETGEAKVILMAM

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G38530		TSBtype2	tryptophan synthase beta type ...		Lus10012746 [exp]	0	1
AT5G10970	C2H2ZnF		C2H2 and C2HC zinc fingers sup...		Lus10026121 [exp]	6.2	0.8348
AT5G66550			Maf-like protein (.1)		Lus10036572 [exp]	9.5	0.8332
AT4G37740	GRF	ATGRF2	growth-regulating factor 2 (.1...		Lus10008916 [exp]	13.7	0.6824
AT2G24050		eIFiso4G2	eukaryotic translation Initiat...		Lus10036256 [exp]	14.1	0.7800
AT1G75250	MYB	RSM3, ATRL6	RADIALIS-LIKE SANT/MYB 3, RAD-...		Lus10040450 [exp]	16.2	0.6344
AT5G45650			subtilase family protein (.1)		Lus10026062 [exp]	16.5	0.7814
					Lus10007927 [exp]	21.6	0.7795
					Lus10023587 [exp]	23.6	0.7795
AT1G48120			hydrolases;protein serine/thre...		Lus10015869 [exp]	25.5	0.7795
AT4G12570		UPL5	ubiquitin protein ligase 5 (.1...		Lus10039026 [exp]	27.3	0.7795

Compare expression of checked genes

Lus10012746 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.