Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G02950 103 / 4e-29 AtTHO7 Tho complex subunit 7/Mft1p (.1) AT5G16790 99 / 3e-27 AtTHO7 Tho complex subunit 7/Mft1p (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10030532 [exp] 167 / 1e-53 AT5G16790 319 / 3e-111 Tho complex subunit 7/Mft1p (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G080200 [exp] 122 / 4e-36 AT5G16790 315 / 2e-109 Tho complex subunit 7/Mft1p (.1) Potri.013G082900 [exp] 61 / 2e-12 AT5G16790 277 / 1e-94 Tho complex subunit 7/Mft1p (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10012882 pacid=23163047 polypeptide=Lus10012882 locus=Lus10012882.g ID=Lus10012882.BGIv1.0 annot-version=v1.0 ATGCAGCCTCCGAGATCAGAGACGCAGAAGATCATCACTGAGCTTGAGGGGGAGATCGTGGCGTTGGAGACTGAGAACACGGTTGGTTCCAGGATGGTGG AGCTGAGGAAGAAACAGTTTGCTCTGCTGCTTCATGTGGTTGATGAACTGCAAAATACCATAGAGGAAGACCAGAAGAGCTTAATGGAGGAAACTAGAAT GGCAATCGAAGATCAGAAGAGCTTGACGGAGGATGCATCTGCGGCCACAGAGGCGATGGCCATCGACTAG
AA sequence Show only first row Show all	>Lus10012882 pacid=23163047 polypeptide=Lus10012882 locus=Lus10012882.g ID=Lus10012882.BGIv1.0 annot-version=v1.0 MQPPRSETQKIITELEGEIVALETENTVGSRMVELRKKQFALLLHVVDELQNTIEEDQKSLMEETRMAIEDQKSLTEDASAATEAMAID

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G02950		AtTHO7	Tho complex subunit 7/Mft1p (....		Lus10012882 [exp]	0	1
AT1G27350			Ribosome associated membrane p...		Lus10037031 [exp]	2.8	0.7749
AT3G15395			unknown protein		Lus10039067 [exp]	3.0	0.7600
AT5G01600		ATFER1	ARABIDOPSIS THALIANA FERRETIN ...		Lus10012233 [exp]	6.6	0.7650
AT2G41600			Mitochondrial glycoprotein fam...		Lus10042041 [exp]	6.6	0.7242
AT5G25760		PEX4, UBC21	ubiquitin-conjugating enzyme 2...		Lus10011695 [exp]	7.3	0.7472
AT5G04000			unknown protein		Lus10042034 [exp]	10.4	0.7543
AT3G09890			Ankyrin repeat family protein ...		Lus10023911 [exp]	10.6	0.7353
AT3G22430			unknown protein		Lus10021917 [exp]	12.5	0.7144
AT1G73177		APC13, BNS	anaphase-promoting complex 13,...		Lus10029234 [exp]	14.3	0.7059
AT2G36930	C2H2ZnF		zinc finger (C2H2 type) family...		Lus10014426 [exp]	15.2	0.7388

Compare expression of checked genes

Lus10012882 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.