Lus10013161 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G14080 180 / 3e-60 Small nuclear ribonucleoprotein family protein (.1.2)
AT1G19120 161 / 8e-53 Small nuclear ribonucleoprotein family protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10008124 199 / 9e-68 AT3G14080 236 / 3e-82 Small nuclear ribonucleoprotein family protein (.1.2)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.003G068400 190 / 3e-64 AT3G14080 234 / 3e-81 Small nuclear ribonucleoprotein family protein (.1.2)
Potri.001G166600 189 / 1e-63 AT3G14080 233 / 9e-81 Small nuclear ribonucleoprotein family protein (.1.2)
Potri.001G278000 36 / 0.0006 AT1G65700 146 / 3e-47 Small nuclear ribonucleoprotein family protein (.1.2.3)
PFAM info
Representative CDS sequence
>Lus10013161 pacid=23164135 polypeptide=Lus10013161 locus=Lus10013161.g ID=Lus10013161.BGIv1.0 annot-version=v1.0
ATGTCTTGGGCAGGGCCGGAAGATGTCTACCTATCGACTTCTCTCGCCAGCTACCTGGATACAAATGCTGTTCTTGAGGGTGCATGTGAAAGGTTGATTG
TTGGTGATCTTTACTGCGATATACCATTAGGTCTCTACGTAATTCGGGGAGAAAATGTAGTTCTAATCGGGGAGTTGGATCTGGAAAGGGAGGAGCTTCC
TCCACACATGACTCGTGTCTCGACCGCGGAAATTAAGAGGGCACAGAAAGCAGAAAGGGAAGCTTCGGATTTGAAGGGCACTATGCGGAAGAGAATGGAG
TTCCTCGATCTCGATTAG
AA sequence
>Lus10013161 pacid=23164135 polypeptide=Lus10013161 locus=Lus10013161.g ID=Lus10013161.BGIv1.0 annot-version=v1.0
MSWAGPEDVYLSTSLASYLDTNAVLEGACERLIVGDLYCDIPLGLYVIRGENVVLIGELDLEREELPPHMTRVSTAEIKRAQKAEREASDLKGTMRKRME
FLDLD

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT3G14080 Small nuclear ribonucleoprotei... Lus10013161 0 1
AT1G07070 Ribosomal protein L35Ae family... Lus10021121 7.6 0.8042
AT5G46850 unknown protein Lus10040093 8.2 0.7025
AT3G57930 unknown protein Lus10031233 9.2 0.7102
AT2G47640 Small nuclear ribonucleoprotei... Lus10013840 9.7 0.7608
AT5G13470 unknown protein Lus10005318 10.8 0.7088
AT5G41685 Mitochondrial outer membrane t... Lus10004754 11.2 0.7203
AT5G27440 unknown protein Lus10041604 15.2 0.7168
AT5G12080 ATMSL10, MSL10 mechanosensitive channel of sm... Lus10011954 21.6 0.7254
AT2G21240 BBR_BPC BPC4, BBR/BPC4,... basic pentacysteine 4 (.1.2) Lus10042056 21.6 0.6998
AT4G00390 GeBP DNA-binding storekeeper protei... Lus10018859 21.6 0.7406

Lus10013161 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.