Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G22400 66 / 2e-14 ATUGT85A1, UGT85A1 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) AT1G22380 64 / 9e-14 ATUGT85A3 UDP-glucosyl transferase 85A3 (.1) AT1G22360 63 / 1e-13 ATUGT85A2, AT2 UDP-glucosyl transferase 85A2 (.1.2) AT1G22340 63 / 2e-13 ATUGT85A7 UDP-glucosyl transferase 85A7 (.1) AT1G78270 57 / 2e-11 ATUGT85A4 UDP-glucosyl transferase 85A4 (.1) AT1G22370 49 / 2e-08 ATUGT85A5 UDP-glucosyl transferase 85A5 (.1.2) AT2G36970 38 / 0.0001 UDP-Glycosyltransferase superfamily protein (.1) AT3G46670 36 / 0.0004 UGT76E11 UDP-glucosyl transferase 76E11 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010665 [exp] 118 / 3e-33 AT1G22400 516 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10011662 [exp] 94 / 4e-27 AT1G22340 113 / 9e-31 UDP-glucosyl transferase 85A7 (.1) Lus10017542 [exp] 95 / 7e-25 AT1G22400 499 / 4e-174 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10007421 [exp] 87 / 5e-22 AT1G22400 529 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10019364 [exp] 86 / 1e-21 AT1G22400 523 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10000993 [exp] 61 / 8e-13 AT1G22380 563 / 0.0 UDP-glucosyl transferase 85A3 (.1) Lus10039277 [exp] 60 / 3e-12 AT1G22400 499 / 3e-174 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Lus10041055 [exp] 59 / 6e-12 AT1G22360 610 / 0.0 UDP-glucosyl transferase 85A2 (.1.2) Lus10013924 [exp] 59 / 8e-12 AT1G22400 551 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G023700 [exp] 78 / 7e-19 AT1G22370 476 / 2e-165 UDP-glucosyl transferase 85A5 (.1.2) Potri.006G023600 [exp] 76 / 7e-18 AT1G22380 526 / 0.0 UDP-glucosyl transferase 85A3 (.1) Potri.016G021100 [exp] 75 / 1e-17 AT1G22360 505 / 5e-177 UDP-glucosyl transferase 85A2 (.1.2) Potri.016G020400 [exp] 74 / 2e-17 AT1G22340 483 / 4e-168 UDP-glucosyl transferase 85A7 (.1) Potri.004G172700 [exp] 72 / 1e-16 AT1G22370 465 / 3e-161 UDP-glucosyl transferase 85A5 (.1.2) Potri.016G021000 [exp] 72 / 1e-16 AT1G22360 561 / 0.0 UDP-glucosyl transferase 85A2 (.1.2) Potri.006G023151 [exp] 71 / 2e-16 AT1G22400 521 / 0.0 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1) Potri.002G098400 [exp] 71 / 3e-16 AT1G22360 640 / 0.0 UDP-glucosyl transferase 85A2 (.1.2) Potri.016G022500 [exp] 70 / 7e-16 AT1G22340 535 / 0.0 UDP-glucosyl transferase 85A7 (.1) Potri.006G022800 [exp] 69 / 1e-15 AT1G22400 470 / 1e-163 ARABIDOPSIS THALIANA UDP-GLUCOSYL TRANSFERASE 85A1, UDP-Glycosyltransferase superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10013653 pacid=23171574 polypeptide=Lus10013653 locus=Lus10013653.g ID=Lus10013653.BGIv1.0 annot-version=v1.0 ATGGAGATAGAGAAAGATGTGGACAGGGAGGCGGTGGAGGAACTGGTGAGGGAGCTGATGAAGGGGGAGAATGGTAACAAGATGCGGAACAAGGCTCGGG ATTGGGCGAGATTAGCGAGAGAAGCTACGGAGTCACGCGGTTCATCTACACTCGGATTTGATCGAGTGATTAATGAAGTGCTTTTGAAAAAATGA
AA sequence Show only first row Show all	>Lus10013653 pacid=23171574 polypeptide=Lus10013653 locus=Lus10013653.g ID=Lus10013653.BGIv1.0 annot-version=v1.0 MEIEKDVDREAVEELVRELMKGENGNKMRNKARDWARLAREATESRGSSTLGFDRVINEVLLKK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G22360		ATUGT85A2, AT2	UDP-glucosyl transferase 85A2 ...		Lus10013653 [exp]	0	1
AT1G22360		ATUGT85A2, AT2	UDP-glucosyl transferase 85A2 ...		Lus10013652 [exp]	1.0	0.8096
AT4G36750			Quinone reductase family prote...		Lus10024032 [exp]	6.5	0.6761
					Lus10010742 [exp]	8.7	0.7841
AT4G12560		CPR1, CPR30	CONSTITUTIVE EXPRESSER OF PR G...		Lus10008871 [exp]	14.5	0.6769
AT4G02510		TOC86, TOC160, ...	TRANSLOCON AT THE OUTER ENVELO...		Lus10028707 [exp]	15.1	0.7353
AT3G59980			Nucleic acid-binding, OB-fold-...		Lus10025611 [exp]	20.2	0.6901
AT3G55550			Concanavalin A-like lectin pro...		Lus10040276 [exp]	26.5	0.7224
AT4G26500		SUFE1, EMB1374,...	SULFUR E 1, MBRYO DEFECTIVE 13...		Lus10032905 [exp]	28.5	0.7320
AT5G22300		AtNIT4, NIT4	nitrilase 4 (.1)		Lus10011234 [exp]	31.7	0.6863
AT5G41020	MYB		myb family transcription facto...		Lus10041714 [exp]	36.4	0.7279

Compare expression of checked genes

Lus10013653 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.