Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G28480 115 / 4e-34 roxy19, GRX480 Thioredoxin superfamily protein (.1) AT5G14070 91 / 9e-25 ROXY2 Thioredoxin superfamily protein (.1) AT4G15700 81 / 5e-21 Thioredoxin superfamily protein (.1) AT4G15690 80 / 1e-20 Thioredoxin superfamily protein (.1) AT4G33040 81 / 2e-20 Thioredoxin superfamily protein (.1) AT4G15680 78 / 5e-20 Thioredoxin superfamily protein (.1) AT3G02000 79 / 7e-20 ROXY1 Thioredoxin superfamily protein (.1) AT1G03850 79 / 1e-19 ATGRXS13 glutaredoxin 13, Glutaredoxin family protein (.1.2) AT4G15670 77 / 1e-19 Thioredoxin superfamily protein (.1) AT4G15660 77 / 1e-19 Thioredoxin superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018631 [exp] 113 / 3e-33 AT1G28480 127 / 8e-39 Thioredoxin superfamily protein (.1) Lus10039867 [exp] 110 / 4e-32 AT1G28480 127 / 7e-39 Thioredoxin superfamily protein (.1) Lus10035183 [exp] 94 / 1e-25 AT5G14070 148 / 6e-47 Thioredoxin superfamily protein (.1) Lus10041538 [exp] 91 / 2e-24 AT5G14070 134 / 3e-41 Thioredoxin superfamily protein (.1) Lus10017693 [exp] 82 / 7e-22 AT1G28480 100 / 4e-29 Thioredoxin superfamily protein (.1) Lus10023295 [exp] 81 / 2e-20 AT5G14070 123 / 5e-37 Thioredoxin superfamily protein (.1) Lus10011333 [exp] 81 / 3e-20 AT5G14070 151 / 1e-47 Thioredoxin superfamily protein (.1) Lus10033649 [exp] 79 / 3e-20 AT1G28480 100 / 5e-29 Thioredoxin superfamily protein (.1) Lus10038514 [exp] 78 / 2e-19 AT5G14070 122 / 2e-36 Thioredoxin superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G049800 [exp] 134 / 3e-41 AT1G28480 94 / 2e-25 Thioredoxin superfamily protein (.1) Potri.011G058800 [exp] 120 / 6e-36 AT1G28480 102 / 2e-28 Thioredoxin superfamily protein (.1) Potri.017G017300 [exp] 115 / 7e-34 AT1G28480 132 / 3e-40 Thioredoxin superfamily protein (.1) Potri.007G134800 [exp] 114 / 9e-34 AT1G28480 141 / 9e-44 Thioredoxin superfamily protein (.1) Potri.003G167000 [exp] 99 / 6e-28 AT5G14070 150 / 9e-48 Thioredoxin superfamily protein (.1) Potri.001G325800 [exp] 99 / 7e-28 AT3G02000 155 / 6e-50 Thioredoxin superfamily protein (.1) Potri.001G060600 [exp] 96 / 2e-26 AT5G14070 147 / 1e-46 Thioredoxin superfamily protein (.1) Potri.010G021800 [exp] 78 / 8e-20 AT5G18600 163 / 5e-54 Thioredoxin superfamily protein (.1) Potri.008G214500 [exp] 74 / 3e-18 AT3G21460 177 / 2e-59 Glutaredoxin family protein (.1) Potri.014G133800 [exp] 72 / 1e-17 AT1G03020 142 / 1e-45 Thioredoxin superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0172 [flax] [poplar] Thioredoxin PF00462 [flax] [poplar] Glutaredoxin Glutaredoxin
Representative CDS sequence Show only first row Show all	>Lus10013962 pacid=23170119 polypeptide=Lus10013962 locus=Lus10013962.g ID=Lus10013962.BGIv1.0 annot-version=v1.0 ATGCAAGAAACAAATTCAACGGCCGCCGGCGTCGTCGCCGACGTGCAGAAGCTGGTGTCGGAGAACTCAATCATAGTGTTCGGGAGGCGAGGGTGCTGCA TGTGCCACGTGATCAAGCGGCTGCTCAACGGGCTGGGGGTCAACCCGACCGCGTACGAGGTGGACGAGTCGGAGGAGGGACACGTGGCGAAGGAGCTTTC GGCGTTGGTGGACGGCGGGGAGGTGCAGTTCCCGGTGGTGTTCGTCGGCGGGAAGGTGTTCGGCGGGCTGGAGAGGGTGATGGCCACTCATATCTCCGGC GAGCTGGTCCCCATCTTGAAAGACGCCGGCGCTTTGTGGCTGTGA
AA sequence Show only first row Show all	>Lus10013962 pacid=23170119 polypeptide=Lus10013962 locus=Lus10013962.g ID=Lus10013962.BGIv1.0 annot-version=v1.0 MQETNSTAAGVVADVQKLVSENSIIVFGRRGCCMCHVIKRLLNGLGVNPTAYEVDESEEGHVAKELSALVDGGEVQFPVVFVGGKVFGGLERVMATHISG ELVPILKDAGALWL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G28480		roxy19, GRX480	Thioredoxin superfamily protei...		Lus10013962 [exp]	0	1
AT2G01690			ARM repeat superfamily protein...		Lus10034578 [exp]	2.2	0.9461
AT1G18330	MYB	RVE7, EPR1	REVEILLE 7, EARLY-PHYTOCHROME-...		Lus10031322 [exp]	8.2	0.9181
AT3G48240			Octicosapeptide/Phox/Bem1p fam...		Lus10000441 [exp]	15.1	0.9362
AT4G16520		ATG8F	autophagy 8f, Ubiquitin-like s...		Lus10028933 [exp]	16.7	0.9383
AT5G64620		ATC/VIF2, C/VIF...	cell wall / vacuolar inhibitor...		Lus10038738 [exp]	17.9	0.9082
AT1G12780		ATUGE1, UGE1	A. THALIANA UDP-GLC 4-EPIMERAS...		Lus10002246 [exp]	21.3	0.9353
AT3G57520		RS2, ATSIP2	raffinose synthase 2, seed imb...		Lus10007537 [exp]	23.3	0.9193
AT4G30790			unknown protein		Lus10005509 [exp]	23.4	0.9172
AT5G20950			Glycosyl hydrolase family prot...		Lus10010656 [exp]	23.5	0.9273
AT3G02540		RAD23C, RAD23-3	RADIATION SENSITIVE23C, PUTATI...		Lus10034307 [exp]	25.6	0.8976

Compare expression of checked genes

Lus10013962 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.