Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G25315 131 / 4e-41 Expressed protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019851 [exp] 219 / 5e-76 AT4G25315 132 / 2e-41 Expressed protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G189300 [exp] 154 / 6e-50 AT4G25315 138 / 7e-44 Expressed protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF11326 [flax] [poplar] DUF3128 Protein of unknown function (DUF3128)
Representative CDS sequence Show only first row Show all	>Lus10014065 pacid=23156832 polypeptide=Lus10014065 locus=Lus10014065.g ID=Lus10014065.BGIv1.0 annot-version=v1.0 ATGGAATCGGAGTCGGAGGAGGTGAGTACCGCGACGCGCCGTCGTCTGTCATGCACCAAGCACTTCGATGCCCTCTGGTTCTGCTACTCTCCGGTCCATC AGATGCAGCAGTATTATAGGGCGGGAGTGCTCGACAATTGTTCAGGAAAATGGAGTGCTCTCTATGACTGCTTGACTCTCAAGACCAAGAGGTCTTCCGA ACTCGAGGATATACTGGAGAGTCGCGAGAAAGCCAAAACTCACATATGGACTTTCAGGAATAAGGAGGAAGCATCGGTTTACTGGAAGGAGCTATTCGGA GACATGGATGAAGTCGAATGA
AA sequence Show only first row Show all	>Lus10014065 pacid=23156832 polypeptide=Lus10014065 locus=Lus10014065.g ID=Lus10014065.BGIv1.0 annot-version=v1.0 MESESEEVSTATRRRLSCTKHFDALWFCYSPVHQMQQYYRAGVLDNCSGKWSALYDCLTLKTKRSSELEDILESREKAKTHIWTFRNKEEASVYWKELFG DMDEVE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G25315			Expressed protein (.1.2)		Lus10014065 [exp]	0	1
AT2G03350			Protein of unknown function, D...		Lus10030420 [exp]	1.4	0.7984
AT5G65270		AtRABA4a	RAB GTPase homolog A4A (.1)		Lus10025738 [exp]	2.0	0.7830
AT2G03500	GARP		Homeodomain-like superfamily p...		Lus10012056 [exp]	4.2	0.7224
AT5G51840			unknown protein		Lus10031667 [exp]	8.5	0.6861
AT5G36230			ARM repeat superfamily protein...		Lus10029667 [exp]	8.7	0.7216
AT1G21910	AP2_ERF	DREB26	dehydration response element-b...		Lus10028032 [exp]	8.9	0.7043
AT5G66580			unknown protein		Lus10019659 [exp]	16.4	0.7018
AT1G14390			Leucine-rich repeat protein ki...		Lus10030785 [exp]	19.1	0.6842
AT2G24290			Protein of unknown function (D...		Lus10019053 [exp]	26.1	0.6943
AT4G09820	bHLH	BHLH42, TT8, bH...	TRANSPARENT TESTA 8, basic hel...		Lus10022032 [exp]	26.7	0.6842

Compare expression of checked genes

Lus10014065 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.