Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G01780 78 / 3e-18 TPLATE ARM repeat superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10032067 [exp] 116 / 2e-31 AT3G01780 1922 / 0.0 ARM repeat superfamily protein (.1) Lus10014599 [exp] 110 / 2e-29 AT3G01780 1910 / 0.0 ARM repeat superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G334300 [exp] 102 / 2e-26 AT3G01780 1859 / 0.0 ARM repeat superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10014611 pacid=23170887 polypeptide=Lus10014611 locus=Lus10014611.g ID=Lus10014611.BGIv1.0 annot-version=v1.0 ATGCCGGAAGATGAAGTGAAGGAAGCAGCAACAGAGAGGCTACGAATATCGATGGTGCGTATCGCGTTACTAAAAGCTGCACAGCCTCAGCCGAGAAGTC CCAAATCGGAGGTGGAGGACGAAGAGGACGAGGACGAAGATGAGAGGAAGAACAAAAAGGAAGGAAACGAGAAGGAGAAGAAAGAAGAGAAGAAAGGGCC TCAAACGCTGTCGAAACTAACAGCGGAGGAGGTTGAGCATATGGCGCTTCAGTCAGCCGTACTGCAAGAGTGGCACACGTTATGTAAGGAGAGAAGCATC AAAAGCTAG
AA sequence Show only first row Show all	>Lus10014611 pacid=23170887 polypeptide=Lus10014611 locus=Lus10014611.g ID=Lus10014611.BGIv1.0 annot-version=v1.0 MPEDEVKEAATERLRISMVRIALLKAAQPQPRSPKSEVEDEEDEDEDERKNKKEGNEKEKKEEKKGPQTLSKLTAEEVEHMALQSAVLQEWHTLCKERSI KS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G01780		TPLATE	ARM repeat superfamily protein...		Lus10014611 [exp]	0	1
AT3G17980		AtC2	Arabidopsis thaliana C2 domain...		Lus10033585 [exp]	19.1	0.6278
					Lus10035559 [exp]	31.0	0.5978
AT5G59310		LTP4	lipid transfer protein 4 (.1)		Lus10022745 [exp]	32.0	0.5675
AT3G43660			Vacuolar iron transporter (VIT...		Lus10029776 [exp]	46.7	0.5627
AT4G00755			F-box family protein (.1.2)		Lus10041367 [exp]	51.7	0.4774
AT1G16560			Per1-like family protein (.1.2...		Lus10027411 [exp]	60.6	0.5569
AT5G08139			RING/U-box superfamily protein...		Lus10008874 [exp]	91.8	0.5524
AT2G41600			Mitochondrial glycoprotein fam...		Lus10042041 [exp]	111.8	0.5363

Compare expression of checked genes

Lus10014611 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.