Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G53020 100 / 6e-28 RPL24B, STV1 SHORT VALVE1, Ribosomal protein L24e family protein (.1) AT2G36620 100 / 6e-28 RPL24A ribosomal protein L24 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024560 [exp] 119 / 1e-35 AT2G36620 238 / 2e-81 ribosomal protein L24 (.1) Lus10032198 [exp] 119 / 1e-35 AT2G36620 240 / 1e-82 ribosomal protein L24 (.1) Lus10006314 [exp] 119 / 1e-34 AT2G36620 233 / 2e-78 ribosomal protein L24 (.1) Lus10029583 [exp] 118 / 2e-34 AT2G36620 232 / 4e-78 ribosomal protein L24 (.1) Lus10035584 [exp] 107 / 1e-30 AT2G36620 241 / 5e-83 ribosomal protein L24 (.1) Lus10008640 [exp] 107 / 1e-30 AT2G36620 243 / 1e-83 ribosomal protein L24 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G139400 [exp] 116 / 1e-34 AT3G53020 227 / 3e-77 SHORT VALVE1, Ribosomal protein L24e family protein (.1) Potri.012G139500 [exp] 115 / 5e-34 AT3G53020 227 / 3e-77 SHORT VALVE1, Ribosomal protein L24e family protein (.1) Potri.004G085300 [exp] 107 / 6e-31 AT3G53020 199 / 2e-66 SHORT VALVE1, Ribosomal protein L24e family protein (.1) Potri.015G141900 [exp] 105 / 5e-30 AT3G53020 196 / 3e-65 SHORT VALVE1, Ribosomal protein L24e family protein (.1) Potri.003G123101 [exp] 96 / 1e-26 AT3G53020 218 / 8e-74 SHORT VALVE1, Ribosomal protein L24e family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10014637 pacid=23149629 polypeptide=Lus10014637 locus=Lus10014637.g ID=Lus10014637.BGIv1.0 annot-version=v1.0 ATGAAAGGAATGAATGAAGTGGAAAGATGGACAAGGCCAACAATAGATATATCATCAAACGTGCCTTCCAAGCTCACCTCGACCGCCGTGTTCAGGAAGC AACACAAGACGGGCATTGCTGCTGAGGCTGTGAAGAAGAAGAGAAGGACCAACAAGAAGCCTTACTCGAGGTCCATCGTCAGTGCTTCTTTGGAGGTGAT GCAGAAGAGGAGGGCCGAAAAGGCTGAAGTCCGAGATGCTACTCGTGAAGCTGCTATTTGTGAAATCAAGGAGAGGATTAAGAAGACCAAAGATGAGAAA AATGGAAAATAA
AA sequence Show only first row Show all	>Lus10014637 pacid=23149629 polypeptide=Lus10014637 locus=Lus10014637.g ID=Lus10014637.BGIv1.0 annot-version=v1.0 MKGMNEVERWTRPTIDISSNVPSKLTSTAVFRKQHKTGIAAEAVKKKRRTNKKPYSRSIVSASLEVMQKRRAEKAEVRDATREAAICEIKERIKKTKDEK NGK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G36620		RPL24A	ribosomal protein L24 (.1)		Lus10014637 [exp]	0	1
AT1G66230	MYB	ATMYB20	myb domain protein 20 (.1)		Lus10004042 [exp]	2.4	1.0000
					Lus10011962 [exp]	3.5	1.0000
AT2G20340			Pyridoxal phosphate (PLP)-depe...		Lus10012601 [exp]	4.2	1.0000
AT5G40350	MYB	ATMYB24	myb domain protein 24 (.1)		Lus10014557 [exp]	4.7	0.9859
					Lus10022805 [exp]	4.9	1.0000
AT5G05530			RING/U-box superfamily protein...		Lus10024629 [exp]	5.5	1.0000
AT2G15220			Plant basic secretory protein ...		Lus10026579 [exp]	6.0	1.0000
AT1G29460			SAUR-like auxin-responsive pro...		Lus10020430 [exp]	6.5	0.9872
AT3G29090		PME31, ATPME31	A. THALIANA PECTIN METHYLESTER...		Lus10024050 [exp]	6.9	0.9718
AT5G04350			Plant self-incompatibility pro...		Lus10029388 [exp]	7.0	1.0000

Compare expression of checked genes

Lus10014637 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.