Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005426 [exp] 90 / 2e-25 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10015230 pacid=23178796 polypeptide=Lus10015230 locus=Lus10015230.g ID=Lus10015230.BGIv1.0 annot-version=v1.0 ATGAGAGTAACAATTTTCGCTCTTCTCATACTCTTAGCATCGGTTGGGAACAAGAACAGTAGAGCAGAAGCCGGTAGAATTAGGACCACAACAGCCGCCG CCGGTGGCCTAGAGCCGCCGTGCGGACTCATTTGCCGACCAGGTTGTTTTTGCCAGGATTTTGCATGCGTCTGCCCGGAAGTTGAACATCCGGCGGTGGC TTCTGAAATTGAGAATAATGGACCAAAGAATTGA
AA sequence Show only first row Show all	>Lus10015230 pacid=23178796 polypeptide=Lus10015230 locus=Lus10015230.g ID=Lus10015230.BGIv1.0 annot-version=v1.0 MRVTIFALLILLASVGNKNSRAEAGRIRTTTAAAGGLEPPCGLICRPGCFCQDFACVCPEVEHPAVASEIENNGPKN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10015230 [exp]	0	1
					Lus10010306 [exp]	1.0	0.9705
AT4G08850			Leucine-rich repeat receptor-l...		Lus10004046 [exp]	4.4	0.9034
AT4G10850		SWEET7, AtSWEET...	Nodulin MtN3 family protein (....		Lus10023047 [exp]	5.7	0.9444
AT5G12060			Plant self-incompatibility pro...		Lus10023195 [exp]	6.9	0.9444
AT1G64870			unknown protein		Lus10041678 [exp]	6.9	0.9355
AT5G17600			RING/U-box superfamily protein...		Lus10008458 [exp]	8.0	0.9444
AT4G35610	C2H2ZnF		zinc finger (C2H2 type) family...		Lus10035994 [exp]	8.9	0.9427
AT3G14880			unknown protein		Lus10013746 [exp]	9.5	0.8111
AT5G07480		KUOX1	KAR-UP oxidoreductase 1 (.1)		Lus10043000 [exp]	9.8	0.9426
AT1G66980		GDPDL2, SNC4	Glycerophosphodiester phosphod...		Lus10040037 [exp]	10.2	0.8989

Compare expression of checked genes

Lus10015230 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.