Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G28270 101 / 4e-29 RALFL4 ralf-like 4 (.1) AT2G33775 94 / 3e-26 RALFL19 ralf-like 19 (.1) AT4G15800 84 / 5e-22 RALFL33 ralf-like 33 (.1) AT1G02900 77 / 3e-19 RALF1, RALFL1, ATRALF1 RALF-LIKE 1, rapid alkalinization factor 1 (.1) AT3G16570 77 / 5e-19 ATRALF23, RALFL23 ARABIDOPSIS RAPID ALKALINIZATION FACTOR 23, rapid alkalinization factor 23 (.1) AT3G05490 71 / 4e-17 RALFL22 ralf-like 22 (.1) AT4G13950 67 / 1e-15 RALFL31 ralf-like 31 (.1) AT3G23805 57 / 1e-11 RALFL24 ralf-like 24 (.1) AT2G33130 52 / 7e-10 RALF18, RALFL18 ralf-like 18 (.1) AT2G20660 51 / 2e-09 RALFL14 ralf-like 14 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025444 [exp] 228 / 2e-79 AT1G28270 100 / 2e-28 ralf-like 4 (.1) Lus10015431 [exp] 109 / 3e-32 AT1G28270 81 / 7e-21 ralf-like 4 (.1) Lus10005541 [exp] 92 / 2e-25 AT1G28270 69 / 3e-16 ralf-like 4 (.1) Lus10029893 [exp] 83 / 1e-21 AT4G15800 116 / 8e-35 ralf-like 33 (.1) Lus10020647 [exp] 82 / 3e-21 AT4G15800 119 / 5e-36 ralf-like 33 (.1) Lus10015172 [exp] 74 / 2e-18 AT4G15800 107 / 2e-31 ralf-like 33 (.1) Lus10000502 [exp] 72 / 4e-17 AT4G15800 134 / 1e-41 ralf-like 33 (.1) Lus10037512 [exp] 70 / 1e-16 AT4G15800 131 / 9e-41 ralf-like 33 (.1) Lus10022561 [exp] 57 / 2e-11 AT4G13950 100 / 1e-28 ralf-like 31 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G044900 [exp] 115 / 2e-34 AT1G28270 103 / 4e-30 ralf-like 4 (.1) Potri.004G045000 [exp] 115 / 2e-34 AT1G28270 103 / 4e-30 ralf-like 4 (.1) Potri.014G131800 [exp] 78 / 6e-20 AT4G15800 123 / 1e-37 ralf-like 33 (.1) Potri.013G017400 [exp] 78 / 1e-19 AT4G15800 123 / 1e-37 ralf-like 33 (.1) Potri.005G025800 [exp] 77 / 2e-19 AT4G15800 138 / 1e-43 ralf-like 33 (.1) Potri.008G208200 [exp] 77 / 2e-19 AT4G15800 132 / 2e-41 ralf-like 33 (.1) Potri.017G059500 [exp] 59 / 4e-12 AT4G13950 96 / 2e-26 ralf-like 31 (.1) Potri.001G320700 [exp] 52 / 2e-09 AT3G23805 96 / 1e-26 ralf-like 24 (.1) Potri.007G044700 [exp] 52 / 2e-09 AT5G67070 119 / 1e-35 ralf-like 34 (.1) Potri.005G139100 [exp] 47 / 2e-07 AT5G67070 118 / 4e-35 ralf-like 34 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05498 [flax] [poplar] RALF Rapid ALkalinization Factor (RALF)
Representative CDS sequence Show only first row Show all	>Lus10015316 pacid=23178812 polypeptide=Lus10015316 locus=Lus10015316.g ID=Lus10015316.BGIv1.0 annot-version=v1.0 ATGATGAGTTCGAAGCACTGTTTGATCATGCTCGTTGTTCTGGTCATTGTGTCGGCCAGAACGGTGGAGTCCACCTTGCCAACATCGCTGGCAGGGGACG ATCTGGGGATGCAGCTCCACGCGTTCAACAGGGAGTCGGAGTTCATGATGGATTCGGAGATCAACCACAGGATGTTGGCGCAGAGGCAGAGGTACATCAG CTACAAGGCGCTTGCCGCGAATAATATCCCCTGCGGCCGGAGAGGGAGCTCGTACTATGACTGCAGTAAGCACAAGAAGATGAACCCTTATCGTAGGGGG TGCACTGCTGCAACCGGTTGTTACAGGTGGACACATTGA
AA sequence Show only first row Show all	>Lus10015316 pacid=23178812 polypeptide=Lus10015316 locus=Lus10015316.g ID=Lus10015316.BGIv1.0 annot-version=v1.0 MMSSKHCLIMLVVLVIVSARTVESTLPTSLAGDDLGMQLHAFNRESEFMMDSEINHRMLAQRQRYISYKALAANNIPCGRRGSSYYDCSKHKKMNPYRRG CTAATGCYRWTH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G28270		RALFL4	ralf-like 4 (.1)		Lus10015316 [exp]	0	1
AT2G46690			SAUR-like auxin-responsive pro...		Lus10010110 [exp]	3.0	0.9304
AT5G18460			Protein of Unknown Function (D...		Lus10003100 [exp]	11.4	0.9090
AT5G06270			unknown protein		Lus10016982 [exp]	15.2	0.8153
AT4G15760		MO1	monooxygenase 1 (.1.2)		Lus10028081 [exp]	15.5	0.8920
AT2G04305			Magnesium transporter CorA-lik...		Lus10010751 [exp]	18.7	0.9008
AT3G14920			Peptide-N4-(N-acetyl-beta-gluc...		Lus10025775 [exp]	25.9	0.8923
AT5G06270			unknown protein		Lus10021305 [exp]	33.2	0.7642
AT5G28540		BIP1	heat shock protein 70 (Hsp 70)...		Lus10031208 [exp]	34.4	0.8848
AT1G58070			unknown protein		Lus10019953 [exp]	35.0	0.8905
AT1G78060			Glycosyl hydrolase family prot...		Lus10019099 [exp]	36.2	0.8759

Compare expression of checked genes

Lus10015316 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.