Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G17260 105 / 6e-28 NAC ANAC086 NAC domain containing protein 86 (.1) AT1G54330 102 / 2e-27 NAC ANAC020 NAC domain containing protein 20 (.1) AT1G65910 103 / 5e-27 NAC ANAC028 NAC domain containing protein 28 (.1) AT3G17730 99 / 1e-26 NAC ANAC057 NAC domain containing protein 57 (.1) AT3G03200 100 / 9e-26 NAC ANAC045 NAC domain containing protein 45 (.1) AT4G17980 79 / 6e-19 NAC ANAC071 NAC domain containing protein 71 (.1) AT5G66300 78 / 2e-18 NAC ANAC105, VND3 VASCULAR-RELATED NAC-DOMAIN 3, Arabidopsis NAC domain containing protein 105, NAC domain containing protein 105 (.1) AT2G18060 78 / 5e-18 NAC ANAC037, VND1 Arabidopsis NAC domain containing protein 37, vascular related NAC-domain protein 1 (.1) AT5G46590 76 / 2e-17 NAC ANAC096 NAC domain containing protein 96 (.1) AT4G36160 76 / 3e-17 NAC ANAC076, VND2 VASCULAR-RELATED NAC-DOMAIN 2, NAC domain containing protein 76 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007377 [exp] 113 / 2e-30 AT1G65910 431 / 7e-143 NAC domain containing protein 28 (.1) Lus10020794 [exp] 113 / 4e-30 AT5G10360 449 / 8e-153 Ribosomal protein small subunit 6b, embryo defective 3010, Ribosomal protein S6e (.1.2) Lus10010959 [exp] 109 / 6e-29 AT1G65910 389 / 9e-128 NAC domain containing protein 28 (.1) Lus10042284 [exp] 97 / 3e-25 AT3G17730 348 / 1e-121 NAC domain containing protein 57 (.1) Lus10026373 [exp] 97 / 3e-25 AT3G17730 348 / 2e-121 NAC domain containing protein 57 (.1) Lus10035373 [exp] 80 / 1e-18 AT4G17980 280 / 2e-93 NAC domain containing protein 71 (.1) Lus10030978 [exp] 79 / 2e-18 AT4G17980 273 / 6e-91 NAC domain containing protein 71 (.1) Lus10031142 [exp] 76 / 3e-17 AT1G12260 351 / 4e-120 VASCULAR RELATED NAC-DOMAIN PROTEIN 4, EMBRYO DEFECTIVE 2749, NAC 007 (.1) Lus10041822 [exp] 76 / 5e-17 AT2G18060 352 / 3e-120 Arabidopsis NAC domain containing protein 37, vascular related NAC-domain protein 1 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G081000 [exp] 103 / 5e-27 AT1G65910 465 / 4e-156 NAC domain containing protein 28 (.1) Potri.008G081500 [exp] 100 / 1e-26 AT1G54330 316 / 1e-107 NAC domain containing protein 20 (.1) Potri.017G139500 [exp] 102 / 2e-26 AT1G65910 461 / 1e-154 NAC domain containing protein 28 (.1) Potri.010G174600 [exp] 100 / 2e-26 AT1G54330 290 / 2e-97 NAC domain containing protein 20 (.1) Potri.012G038100 [exp] 97 / 2e-25 AT3G17730 339 / 4e-118 NAC domain containing protein 57 (.1) Potri.015G030200 [exp] 96 / 3e-25 AT3G17730 374 / 6e-133 NAC domain containing protein 57 (.1) Potri.003G089800 [exp] 78 / 4e-18 AT4G17980 319 / 6e-109 NAC domain containing protein 71 (.1) Potri.001G144400 [exp] 78 / 7e-18 AT4G17980 318 / 2e-108 NAC domain containing protein 71 (.1) Potri.015G127400 [exp] 76 / 3e-17 AT1G12260 378 / 4e-130 VASCULAR RELATED NAC-DOMAIN PROTEIN 4, EMBRYO DEFECTIVE 2749, NAC 007 (.1) Potri.007G014400 [exp] 76 / 3e-17 AT2G18060 427 / 1e-149 Arabidopsis NAC domain containing protein 37, vascular related NAC-domain protein 1 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02365 [flax] [poplar] NAM No apical meristem (NAM) protein
Representative CDS sequence Show only first row Show all	>Lus10015554 pacid=23173634 polypeptide=Lus10015554 locus=Lus10015554.g ID=Lus10015554.BGIv1.0 annot-version=v1.0 ATGGCTCCTGTTTCATTGCCACCTGGCTTTCGATTCCACCCAGCCGACGAGGAGCTGGTTGCTTACTACCTGAAGAGCAAGATCAACGGGCAGAAGATTG AGCTCGAGATCATCCCTGAAGTCGAGCTTTACAAGTGCGAGCCCTGGGATTGGCCTGGGAATGCTGGACGCCTCTCTGAGACGAAGAAGGCTGAGCGAAA CCGACCAGCAAACAATCTTACGGAGGTCTCGGGCGTTGGCAACGAGGCTCGAAGCTTCCTAGAAGCGGAGAAATCTCACCAACGTCCGTTCTCTTTGTAT AATGTGAAAACAACGAACTTTTATGGACTGCGAGAGGTAAAAAAACTGACTGAATAA
AA sequence Show only first row Show all	>Lus10015554 pacid=23173634 polypeptide=Lus10015554 locus=Lus10015554.g ID=Lus10015554.BGIv1.0 annot-version=v1.0 MAPVSLPPGFRFHPADEELVAYYLKSKINGQKIELEIIPEVELYKCEPWDWPGNAGRLSETKKAERNRPANNLTEVSGVGNEARSFLEAEKSHQRPFSLY NVKTTNFYGLREVKKLTE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G65910	NAC	ANAC028	NAC domain containing protein ...		Lus10015554 [exp]	0	1
AT1G59960			NAD(P)-linked oxidoreductase s...		Lus10011056 [exp]	15.3	0.8791
					Lus10000300 [exp]	21.5	0.8548
AT1G80460		GLI1, NHO1	nonhost resistance to P. s. ph...		Lus10035914 [exp]	29.5	0.8373
AT4G22310			Uncharacterised protein family...		Lus10032564 [exp]	56.0	0.7887
AT4G16120		ATSEB1, COBL7	ARABIDOPSIS THALIANA SEC61 BET...		Lus10010022 [exp]	56.7	0.7964
AT5G25900		ATKO1, CYP701A3...	CYTOCHROME P450 701 A3, ARABID...		Lus10042641 [exp]	69.7	0.7768
AT5G67265			unknown protein		Lus10042633 [exp]	79.6	0.8023
					Lus10003493 [exp]	82.7	0.8170
AT4G31540		ATEXO70G1	exocyst subunit exo70 family p...		Lus10007751 [exp]	105.1	0.7953
AT1G25520			Uncharacterized protein family...		Lus10021697 [exp]	151.7	0.7986

Compare expression of checked genes

Lus10015554 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.