Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G48140 150 / 3e-49 B12D protein (.1) AT3G29970 99 / 1e-28 B12D protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10036977 [exp] 166 / 5e-55 AT3G48140 132 / 9e-42 B12D protein (.1) Lus10004241 [exp] 132 / 8e-42 AT3G48140 132 / 4e-42 B12D protein (.1) Lus10042151 [exp] 132 / 8e-42 AT3G48140 132 / 4e-42 B12D protein (.1) Lus10035132 [exp] 96 / 2e-27 AT3G29970 112 / 5e-34 B12D protein (.1) Lus10031971 [exp] 44 / 2e-06 AT5G60335 152 / 5e-47 Thioesterase superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G179401 [exp] 160 / 5e-53 AT3G48140 137 / 8e-44 B12D protein (.1) Potri.010G055300 [exp] 158 / 3e-51 AT3G48140 132 / 8e-41 B12D protein (.1) Potri.012G074900 [exp] 141 / 2e-45 AT3G48140 137 / 8e-44 B12D protein (.1) Potri.017G098800 [exp] 108 / 9e-33 AT3G29970 131 / 9e-42 B12D protein (.1) Potri.004G117300 [exp] 106 / 9e-32 AT3G29970 126 / 9e-40 B12D protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF06522 [flax] [poplar] B12D NADH-ubiquinone reductase complex 1 MLRQ subunit
Representative CDS sequence Show only first row Show all	>Lus10015825 pacid=23167693 polypeptide=Lus10015825 locus=Lus10015825.g ID=Lus10015825.BGIv1.0 annot-version=v1.0 ATGTCTACTGCTTCAAGATGGATTCGACCTGAGGTGTTCCCTCTGTTTGCTTCCGTGGGTGTCGCCGTCGGGATTTGCGCGATGCAGCTCGTCAGGAATA TCACCGGAAATCCTGAAGTCAGGGTGACTAAAGAAAACAGGGCAGCTGGGATTCTTGACAACCATAAAGAAGGTGAGAAGTACAAAGAACATGGGCTGAG GAGGTTCGTTCGTACTAAGCGCCCTGAGATCATGCCAGGGATCAATGGCTTCTTCTCCGATCCTCAGCTTCGAGGCCGTTGA
AA sequence Show only first row Show all	>Lus10015825 pacid=23167693 polypeptide=Lus10015825 locus=Lus10015825.g ID=Lus10015825.BGIv1.0 annot-version=v1.0 MSTASRWIRPEVFPLFASVGVAVGICAMQLVRNITGNPEVRVTKENRAAGILDNHKEGEKYKEHGLRRFVRTKRPEIMPGINGFFSDPQLRGR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G48140			B12D protein (.1)		Lus10015825 [exp]	0	1
AT5G40010		ASD, AATP1	ATPase-in-Seed-Development, AA...		Lus10015349 [exp]	8.9	0.9093
AT2G18210			unknown protein		Lus10041771 [exp]	11.3	0.9261
AT3G48140			B12D protein (.1)		Lus10036977 [exp]	16.7	0.9376
AT5G46250			RNA-binding protein (.1.2.3)		Lus10038494 [exp]	17.5	0.8916
AT5G22390			Protein of unknown function (D...		Lus10020626 [exp]	29.1	0.8722
AT4G04960			Concanavalin A-like lectin pro...		Lus10018602 [exp]	30.2	0.8953
					Lus10011681 [exp]	31.9	0.9093
AT4G39720			VQ motif-containing protein (....		Lus10016814 [exp]	41.7	0.8988
AT3G12360		ITN1	INCREASED TOLERANCE TO NACL, A...		Lus10040335 [exp]	44.1	0.8773
AT4G20380		LSD1	LESION SIMULATING DISEASE, LSD...		Lus10008066 [exp]	49.4	0.8926

Compare expression of checked genes

Lus10015825 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.