Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G07568 78 / 6e-21 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012305 [exp] 116 / 5e-34 AT3G07570 165 / 8e-49 Cytochrome b561/ferric reductase transmembrane with DOMON related domain (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G197400 [exp] 86 / 4e-24 AT3G07568 76 / 4e-20 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10016081 pacid=23154350 polypeptide=Lus10016081 locus=Lus10016081.g ID=Lus10016081.BGIv1.0 annot-version=v1.0 ATGAGGACTCGATTAGTATGGTTCACGGTGGGGTTTTCCGTCTCCGGAGCTGCCATTGCACAGTTCGTCGGCCGGGATCTATGGACCGAGCGAATGGCTC TCTCATTTCATATGAAGCATAAGATGGATTCTCTCGAAGCTCGGATCTCCAATCTCGAGTCTATCACTGCACAGAACTCGACTGCTGCTCAGGTTAAGGA ATAG
AA sequence Show only first row Show all	>Lus10016081 pacid=23154350 polypeptide=Lus10016081 locus=Lus10016081.g ID=Lus10016081.BGIv1.0 annot-version=v1.0 MRTRLVWFTVGFSVSGAAIAQFVGRDLWTERMALSFHMKHKMDSLEARISNLESITAQNSTAAQVKE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G07568			unknown protein		Lus10016081 [exp]	0	1
AT5G19151			unknown protein		Lus10034040 [exp]	4.7	0.7490
					Lus10027957 [exp]	6.6	0.8013
AT2G21250			NAD(P)-linked oxidoreductase s...		Lus10018058 [exp]	20.6	0.7282
					Lus10011047 [exp]	24.5	0.7834
AT2G32180		PTAC18	plastid transcriptionally acti...		Lus10035307 [exp]	25.4	0.7783
AT4G04900		RIC10	ROP-interactive CRIB motif-con...		Lus10007648 [exp]	25.8	0.7670
AT4G13590			Uncharacterized protein family...		Lus10023685 [exp]	35.4	0.7554
AT5G62280			Protein of unknown function (D...		Lus10031701 [exp]	38.7	0.7554
AT5G42300		UBL5	ubiquitin-like protein 5 (.1)		Lus10019939 [exp]	49.3	0.6485
					Lus10030382 [exp]	56.2	0.6969

Compare expression of checked genes

Lus10016081 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.