Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G64140 84 / 1e-23 RPS28 ribosomal protein S28 (.1) AT5G03850 84 / 1e-23 Nucleic acid-binding, OB-fold-like protein (.1) AT3G10090 84 / 1e-23 Nucleic acid-binding, OB-fold-like protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10029320 [exp] 103 / 4e-31 AT3G10090 111 / 3e-34 Nucleic acid-binding, OB-fold-like protein (.1) Lus10017293 [exp] 105 / 6e-31 AT3G10090 113 / 1e-33 Nucleic acid-binding, OB-fold-like protein (.1) Lus10013543 [exp] 100 / 2e-28 AT5G64140 114 / 4e-33 ribosomal protein S28 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G063100 [exp] 95 / 9e-28 AT5G64140 89 / 1e-25 ribosomal protein S28 (.1) Potri.008G013200 [exp] 94 / 1e-27 AT5G64140 90 / 5e-26 ribosomal protein S28 (.1) Potri.010G245400 [exp] 94 / 1e-27 AT5G64140 90 / 5e-26 ribosomal protein S28 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0021 [flax] [poplar] OB PF01200 [flax] [poplar] Ribosomal_S28e Ribosomal protein S28e
Representative CDS sequence Show only first row Show all	>Lus10016222 pacid=23142692 polypeptide=Lus10016222 locus=Lus10016222.g ID=Lus10016222.BGIv1.0 annot-version=v1.0 ATGGAATCAGGAATCAAGCACGCTCTAGTTGTGAAGGTGATGGGCCGTACCGGATCCAGGGGGCAGGTGACTCAGGTCAGGGTTAAGTTCATCGACGATC CGAACCGTTTCATCATGAGGAATGTCAAGGGACCCGTGAGAGAAGGTGACATCCTCACCTTGCTCGAGTCCGAGAGAGAGGCCAGGAGACTTCGTTGA
AA sequence Show only first row Show all	>Lus10016222 pacid=23142692 polypeptide=Lus10016222 locus=Lus10016222.g ID=Lus10016222.BGIv1.0 annot-version=v1.0 MESGIKHALVVKVMGRTGSRGQVTQVRVKFIDDPNRFIMRNVKGPVREGDILTLLESEREARRLR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G10090			Nucleic acid-binding, OB-fold-...		Lus10016222 [exp]	0	1
AT1G41880			Ribosomal protein L35Ae family...		Lus10028254 [exp]	3.0	0.9451
AT5G56710			Ribosomal protein L31e family ...		Lus10037703 [exp]	3.5	0.9400
AT5G64680			unknown protein		Lus10018951 [exp]	6.6	0.8927
AT2G20450			Ribosomal protein L14 (.1)		Lus10008246 [exp]	6.9	0.9202
AT5G27700			Ribosomal protein S21e (.1)		Lus10015173 [exp]	7.2	0.9402
AT4G14320			Zinc-binding ribosomal protein...		Lus10010195 [exp]	8.0	0.9368
AT4G33250		ATTIF3K1, EIF3K	eukaryotic translation initiat...		Lus10027668 [exp]	11.5	0.9210
AT4G09800		RPS18C	S18 ribosomal protein (.1)		Lus10022057 [exp]	12.2	0.9328
AT5G56670			Ribosomal protein S30 family p...		Lus10017473 [exp]	12.6	0.9125
AT1G34030			Ribosomal protein S13/S18 fami...		Lus10014676 [exp]	13.4	0.9280

Compare expression of checked genes

Lus10016222 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.