Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018199 [exp] 132 / 3e-40 ND / Lus10039637 [exp] 122 / 3e-37 ND / Lus10010249 [exp] 120 / 3e-36 ND / Lus10022164 [exp] 109 / 3e-32 ND / Lus10000712 [exp] 110 / 5e-32 ND / Lus10021178 [exp] 110 / 1e-31 ND / Lus10008152 [exp] 107 / 5e-31 ND / Lus10000467 [exp] 107 / 1e-30 ND 37 / 0.005 Lus10004836 [exp] 107 / 2e-30 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10016868 pacid=23179067 polypeptide=Lus10016868 locus=Lus10016868.g ID=Lus10016868.BGIv1.0 annot-version=v1.0 ATGGTTTACCAAATTTCAACGGTGCGGCCAGATGGAGTTCACGTGCTAGAGTCAGTGTCGAGGCCTACTGATGGAGCACAATACTCATTTAAGCAATCAA AGTGGGACTACAACCGTCAGAGTTTGTTGACACACTTACCCTTCTTTAGCACTCGCAGTGTGCCAGGAGTTGCCGACGGTAACGCGTCTGATGAGTACAT GGAGTGGTATCTCCACCGCACACACCCGACGATCGTCCCCACGCACGCACAAGATGAGCCACATGCCCCGTTGGAACCAGAGCAGGTCATGCATACTTTC TGTGCCGGTTTGGCCCCCTTAGTCGTAGCCGAGGAGGACAAGATTTTTTGA
AA sequence Show only first row Show all	>Lus10016868 pacid=23179067 polypeptide=Lus10016868 locus=Lus10016868.g ID=Lus10016868.BGIv1.0 annot-version=v1.0 MVYQISTVRPDGVHVLESVSRPTDGAQYSFKQSKWDYNRQSLLTHLPFFSTRSVPGVADGNASDEYMEWYLHRTHPTIVPTHAQDEPHAPLEPEQVMHTF CAGLAPLVVAEEDKIF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10016868 [exp]	0	1
AT5G12460			Protein of unknown function (D...		Lus10003179 [exp]	4.9	1.0000
AT1G18720			Protein of unknown function (D...		Lus10001647 [exp]	5.0	1.0000
					Lus10003763 [exp]	6.0	1.0000
AT4G37580		UNS2, COP3, HLS...	UNUSUAL SUGAR RESPONSE 2, HOOK...		Lus10016904 [exp]	8.1	0.9956
					Lus10006079 [exp]	8.9	1.0000
					Lus10010414 [exp]	10.0	1.0000
AT2G22620			Rhamnogalacturonate lyase fami...		Lus10010628 [exp]	11.0	1.0000
					Lus10010663 [exp]	11.2	1.0000
AT4G28780			GDSL-like Lipase/Acylhydrolase...		Lus10023578 [exp]	12.6	1.0000
AT1G15780			unknown protein		Lus10023978 [exp]	13.4	1.0000

Compare expression of checked genes

Lus10016868 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.