Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G17930 46 / 8e-07 Aminotransferase-like, plant mobile domain family protein (.1) AT2G04865 40 / 8e-05 Aminotransferase-like, plant mobile domain family protein (.1) AT2G25010 40 / 0.0001 Aminotransferase-like, plant mobile domain family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021566 [exp] 152 / 2e-47 AT1G17930 54 / 4e-08 Aminotransferase-like, plant mobile domain family protein (.1) Lus10033313 [exp] 153 / 9e-47 AT1G17930 72 / 1e-13 Aminotransferase-like, plant mobile domain family protein (.1) Lus10006165 [exp] 144 / 4e-44 AT5G45260 66 / 5e-12 SENSITIVE TO LOW HUMIDITY 1, RESISTANT TO RALSTONIA SOLANACEARUM 1, ARABIDOPSIS THALIANA WRKY DOMAIN PROTEIN 52, Disease resistance protein (TIR-NBS-LRR class) (.1), Disease resistance protein (TIR-NBS-LRR class) (.2) Lus10039393 [exp] 144 / 5e-44 AT1G17930 73 / 3e-14 Aminotransferase-like, plant mobile domain family protein (.1) Lus10005957 [exp] 136 / 2e-40 AT1G48120 75 / 1e-14 hydrolases;protein serine/threonine phosphatases (.1) Lus10011276 [exp] 131 / 5e-39 ND 42 / 2e-04 Lus10000686 [exp] 122 / 2e-36 AT1G17930 87 / 3e-20 Aminotransferase-like, plant mobile domain family protein (.1) Lus10037814 [exp] 108 / 6e-32 ND 37 / 0.001 Lus10027047 [exp] 114 / 7e-31 AT1G17930 119 / 1e-28 Aminotransferase-like, plant mobile domain family protein (.1)
Poplar homologues Show only best Show top 10	No hit found
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF10536 [flax] [poplar] PMD Plant mobile domain
Representative CDS sequence Show only first row Show all	>Lus10016922 pacid=23159612 polypeptide=Lus10016922 locus=Lus10016922.g ID=Lus10016922.BGIv1.0 annot-version=v1.0 ATGGTAGGCGCCTCAACTGTGTCACGGTATGCTTGGGGGACGGGCGCGCTAGAATGGTTGTACCATGAGCTTGGTAAGGCTAGCCGCGCCAAGTGCAATT GGATGGCAGGCTGCATTTCACTACTTGAGTCTTGGATCCACGAGTATTTTCCTAGTACTCGTGCTGCTAGAGTCGTGTGCCAGGCACGGGGCGAGGGTGA GGCATTAGTTCGGCGGTGGAGCAGTGACGACCAGTTAGAGCGGTCGTACTACTTCATGCACCATAGGTTGGAGTATTACCGTTATCTCCTTGATGATATG ACTGCACGTGATGTGACCTAG
AA sequence Show only first row Show all	>Lus10016922 pacid=23159612 polypeptide=Lus10016922 locus=Lus10016922.g ID=Lus10016922.BGIv1.0 annot-version=v1.0 MVGASTVSRYAWGTGALEWLYHELGKASRAKCNWMAGCISLLESWIHEYFPSTRAARVVCQARGEGEALVRRWSSDDQLERSYYFMHHRLEYYRYLLDDM TARDVT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G17930			Aminotransferase-like, plant m...		Lus10016922 [exp]	0	1
					Lus10007927 [exp]	3.2	1.0000
					Lus10023587 [exp]	4.5	1.0000
AT2G25470		AtRLP21	receptor like protein 21 (.1)		Lus10027855 [exp]	5.3	1.0000
AT1G74670		GASA6	GA-stimulated Arabidopsis 6, G...		Lus10024216 [exp]	5.5	1.0000
AT3G20800			Cell differentiation, Rcd1-lik...		Lus10031542 [exp]	6.5	1.0000
AT3G19540			Protein of unknown function (D...		Lus10028040 [exp]	7.1	1.0000
AT1G48120			hydrolases;protein serine/thre...		Lus10015869 [exp]	8.4	1.0000
AT2G34320			Polynucleotidyl transferase, r...		Lus10039942 [exp]	8.5	1.0000
AT4G12570		UPL5	ubiquitin protein ligase 5 (.1...		Lus10039026 [exp]	8.9	1.0000
AT1G28030			2-oxoglutarate (2OG) and Fe(II...		Lus10012760 [exp]	9.2	0.9815

Compare expression of checked genes

Lus10016922 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.