Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G23390 47 / 2e-07 Plant protein of unknown function (DUF639) (.1) AT1G48840 44 / 2e-06 Plant protein of unknown function (DUF639) (.1) AT1G71240 39 / 0.0001 Plant protein of unknown function (DUF639) (.1), Plant protein of unknown function (DUF639) (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010155 [exp] 93 / 8e-24 AT5G23390 781 / 0.0 Plant protein of unknown function (DUF639) (.1) Lus10002408 [exp] 37 / 0.0006 AT1G71240 941 / 0.0 Plant protein of unknown function (DUF639) (.1), Plant protein of unknown function (DUF639) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G003000 [exp] 73 / 6e-17 AT5G23390 730 / 0.0 Plant protein of unknown function (DUF639) (.1) Potri.015G046500 [exp] 49 / 3e-08 AT1G48840 942 / 0.0 Plant protein of unknown function (DUF639) (.1) Potri.012G055800 [exp] 46 / 3e-07 AT1G48840 894 / 0.0 Plant protein of unknown function (DUF639) (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0484 [flax] [poplar] Peroxisome PF04842 [flax] [poplar] DUF639 Plant protein of unknown function (DUF639)
Representative CDS sequence Show only first row Show all	>Lus10017360 pacid=23140174 polypeptide=Lus10017360 locus=Lus10017360.g ID=Lus10017360.BGIv1.0 annot-version=v1.0 ATGTTGGATATTAGGAAAGCTGAGGCGGCTCAGGGTACGGCGGGTAAGGTTAAGGTTGAAGGCATTGATACAAATGTTGCCGTTATGAAGGCTACAGAGA GGATTGCACTACTACTGTTGTTTGTAGCCATTGTAATGATGATGGTGCCTTTGAGGCACTTGGTGCTACTAGTGTTCTTAGAGACTTTCACCAGAGAAAT GCCTTACAGGAAAGAAAGTAGCGATGGATGA
AA sequence Show only first row Show all	>Lus10017360 pacid=23140174 polypeptide=Lus10017360 locus=Lus10017360.g ID=Lus10017360.BGIv1.0 annot-version=v1.0 MLDIRKAEAAQGTAGKVKVEGIDTNVAVMKATERIALLLLFVAIVMMMVPLRHLVLLVFLETFTREMPYRKESSDG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G48840			Plant protein of unknown funct...		Lus10017360 [exp]	0	1

Compare expression of checked genes

Lus10017360 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.