Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10028838 [exp] 109 / 6e-32 AT3G52230 77 / 3e-18 unknown protein Lus10037916 [exp] 66 / 4e-14 AT3G52230 78 / 5e-18 unknown protein Lus10038643 [exp] 63 / 1e-13 AT3G52230 75 / 6e-18 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G233400 [exp] 56 / 3e-11 AT3G52230 74 / 1e-17 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10017445 pacid=23163112 polypeptide=Lus10017445 locus=Lus10017445.g ID=Lus10017445.BGIv1.0 annot-version=v1.0 ATGGCGGACAAGAACGGAAGCATAGTGGAATCCAAGGAGACCAACAAGGGTCCCTTCTCTTTCCTTGCCAACTTCAACTTTCCGAACCCTTTCCTCAACC TCGAGAAACGACCAGATACTCCTTCTTCTACTGAGCTGGAGAAAGAAAGTCAACCCTCTAAATCTACAGCGGTGAGGTTTCCAAACCCCCGTTCAGTGCT TCCTCCTCCGATTGAAACCGAGGTTGAAGACAGCTCTGGCAAAACTCACAATCCCGTTGTTATCTGGCAGCGGGTGAAGGTTGGAATTATGAACATTCAT GCTTGA
AA sequence Show only first row Show all	>Lus10017445 pacid=23163112 polypeptide=Lus10017445 locus=Lus10017445.g ID=Lus10017445.BGIv1.0 annot-version=v1.0 MADKNGSIVESKETNKGPFSFLANFNFPNPFLNLEKRPDTPSSTELEKESQPSKSTAVRFPNPRSVLPPPIETEVEDSSGKTHNPVVIWQRVKVGIMNIH A

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10017445 [exp]	0	1
AT4G15560		AtCLA1, DXS, DX...	1-DEOXY-D-XYLULOSE 5-PHOSPHATE...		Lus10015517 [exp]	10.3	0.8824
AT4G31180			Class II aminoacyl-tRNA and bi...		Lus10028555 [exp]	10.4	0.8902
AT5G24530		DMR6	DOWNY MILDEW RESISTANT 6, 2-ox...		Lus10000711 [exp]	19.2	0.8741
AT4G35470		PIRL4, DREB1C	plant intracellular ras group-...		Lus10000900 [exp]	20.8	0.8620
AT4G36380		ROT3	ROTUNDIFOLIA 3, Cytochrome P45...		Lus10028345 [exp]	21.6	0.8414
AT2G37710		RLK	receptor lectin kinase (.1)		Lus10014651 [exp]	26.1	0.8376
AT2G17290		ATCPK6, ATCDPK3...	calcium dependent protein kina...		Lus10013842 [exp]	28.6	0.8553
AT3G16565			alanine-tRNA ligases;nucleic a...		Lus10000503 [exp]	30.0	0.8671
AT2G43320			S-adenosyl-L-methionine-depend...		Lus10015953 [exp]	32.7	0.8694
AT1G78850			D-mannose binding lectin prote...		Lus10000579 [exp]	34.4	0.8395

Compare expression of checked genes

Lus10017445 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.