Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G03770 114 / 3e-31 AtKdtA, KDTA KDO transferase A (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10033622 [exp] 169 / 2e-52 AT5G03770 488 / 7e-172 KDO transferase A (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G095900 [exp] 130 / 2e-37 AT5G03770 538 / 0.0 KDO transferase A (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0113 [flax] [poplar] GT-B PF04413 [flax] [poplar] Glycos_transf_N 3-Deoxy-D-manno-octulosonic-acid transferase (kdotransferase)
Representative CDS sequence Show only first row Show all	>Lus10017663 pacid=23155585 polypeptide=Lus10017663 locus=Lus10017663.g ID=Lus10017663.BGIv1.0 annot-version=v1.0 ATGGCTGCGATCCCTGTCATCAAGCAGTGCGTTCACCGGAGGCCTGATTTGAACGTTCTTATGACGACTACGACAGCGTCTGCGTTTAAAGTTATCGAGA ATGATATTCCAGATGGTGTTCTATACCAGTTTTGTCCTGTGGATACCCCTTCTGCCATGGATGCTTTCCTGAGCTACTGGAAGTCAACAGCAATTATCTT ACTGGAGAGCGAACTATGGCCGAATCTAATCATGGTTTCTTCAGCTATGGGTGTAGGTTATCCACCTTTCCATACGTATTAG
AA sequence Show only first row Show all	>Lus10017663 pacid=23155585 polypeptide=Lus10017663 locus=Lus10017663.g ID=Lus10017663.BGIv1.0 annot-version=v1.0 MAAIPVIKQCVHRRPDLNVLMTTTTASAFKVIENDIPDGVLYQFCPVDTPSAMDAFLSYWKSTAIILLESELWPNLIMVSSAMGVGYPPFHTY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G03770		AtKdtA, KDTA	KDO transferase A (.1)		Lus10017663 [exp]	0	1
AT1G79050			recA DNA recombination family ...		Lus10042462 [exp]	16.0	0.6030
AT4G15440		CYP74B2, HPL1	hydroperoxide lyase 1 (.1)		Lus10035294 [exp]	31.7	0.5498
AT2G02955		MEE12	maternal effect embryo arrest ...		Lus10034719 [exp]	44.2	0.5316
AT3G01610		CDC48C, EMB1354	embryo defective 1354, cell di...		Lus10018508 [exp]	68.6	0.4997
AT4G10950			SGNH hydrolase-type esterase s...		Lus10026771 [exp]	109.0	0.4899
AT1G61250		SC3	secretory carrier 3 (.1.2)		Lus10038302 [exp]	166.7	0.4462

Compare expression of checked genes

Lus10017663 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.