Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G16385 43 / 1e-06 unknown protein AT4G34600 39 / 5e-05 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G119900 [exp] 48 / 2e-08 AT2G16385 56 / 1e-11 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10017979 pacid=23147883 polypeptide=Lus10017979 locus=Lus10017979.g ID=Lus10017979.BGIv1.0 annot-version=v1.0 ATGGAGGTTGGTCATCATGGTGTGAAGAAATGTGGTGGGATAACGGTGTTGCTTCTACTTCTCATCTCCTCTGCACTATTATTGTCCTTCCCTCCTCTCT GTCTTGCAGCTGGTCGAGGATTCGAATTGAATAGTCATGAAGACAGCAAGAAGCTGGGTGAAGGTGTCATCCCTTCTTTTGAGAGAGAAGTAGTAGTAAG GGAGAGGGTACTGAGAGCAAACACAAAAGACTATGGAAGCTATGATCCAACGCCAGCTCTTTCCAAGCCCCGTTTCAAGCTCATTCCTAACTGA
AA sequence Show only first row Show all	>Lus10017979 pacid=23147883 polypeptide=Lus10017979 locus=Lus10017979.g ID=Lus10017979.BGIv1.0 annot-version=v1.0 MEVGHHGVKKCGGITVLLLLLISSALLLSFPPLCLAAGRGFELNSHEDSKKLGEGVIPSFEREVVVRERVLRANTKDYGSYDPTPALSKPRFKLIPN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G16385			unknown protein		Lus10017979 [exp]	0	1
AT1G67710	GARP	ARR11	response regulator 11 (.1)		Lus10006446 [exp]	2.8	0.9372
AT1G62040		ATG8C	autophagy 8c, Ubiquitin-like s...		Lus10015563 [exp]	3.0	0.9558
					Lus10034710 [exp]	6.3	0.9225
AT2G46680	HD	ATHB7, ATHB-7	ARABIDOPSIS THALIANA HOMEOBOX ...		Lus10008840 [exp]	11.5	0.9437
AT3G07680			emp24/gp25L/p24 family/GOLD fa...		Lus10036603 [exp]	11.7	0.9407
AT5G01520		AtAIRP2, AIRP2	ABA Insensitive RING Protein 2...		Lus10002491 [exp]	13.4	0.9196
AT5G12010			unknown protein		Lus10024997 [exp]	15.0	0.9099
AT5G19440			NAD(P)-binding Rossmann-fold s...		Lus10014363 [exp]	19.0	0.9165
AT4G24460		CLT2	CRT (chloroquine-resistance tr...		Lus10008964 [exp]	24.1	0.8889
AT2G39920			HAD superfamily, subfamily III...		Lus10028259 [exp]	24.6	0.9302

Compare expression of checked genes

Lus10017979 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.