Lus10018283 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G31310 82 / 7e-20 Trihelix hydroxyproline-rich glycoprotein family protein (.1)
AT2G35640 77 / 3e-18 Trihelix Homeodomain-like superfamily protein (.1)
AT2G33550 38 / 0.0004 Trihelix Homeodomain-like superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10040628 70 / 7e-17 AT2G35640 69 / 5e-24 Homeodomain-like superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.012G117500 79 / 1e-18 AT2G35640 184 / 2e-55 Homeodomain-like superfamily protein (.1)
Potri.003G163000 39 / 0.0002 AT2G33550 340 / 9e-117 Homeodomain-like superfamily protein (.1)
Potri.001G066900 37 / 0.0006 AT2G33550 328 / 4e-112 Homeodomain-like superfamily protein (.1)
PFAM info
Representative CDS sequence
>Lus10018283 pacid=23179387 polypeptide=Lus10018283 locus=Lus10018283.g ID=Lus10018283.BGIv1.0 annot-version=v1.0
ATGTGGGAGTGGAGGGGGGGGGGAGGGGAGAGAGGAGGGGAAGGGGGAGGCGGCGGGGGAGGAGGAGGAGGAGGAGGAAACTCCACCACCGGCAGCAGCA
GCGGAAGTAAGGCCGGCGGGGAGCTGCGGTGGAAGTGGGTGGAGGATTACTGTTGGAAGAAAGGCTGCTTCCGTAGTCAGAACCAGTGCAACGACAAGTG
GGACAACTTAATGCGCGACTACAAGAAAGTCCGCGACCACCCCCCCCGCCGCCGCCACCGCCGGAGAAACGGAAGCTGGAGGTAG
AA sequence
>Lus10018283 pacid=23179387 polypeptide=Lus10018283 locus=Lus10018283.g ID=Lus10018283.BGIv1.0 annot-version=v1.0
MWEWRGGGGERGGEGGGGGGGGGGGGNSTTGSSSGSKAGGELRWKWVEDYCWKKGCFRSQNQCNDKWDNLMRDYKKVRDHPPRRRHRRRNGSWR

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT2G35640 Trihelix Homeodomain-like superfamily p... Lus10018283 0 1
AT2G02540 ZF_HD ATHB21, ZFHD4, ... ZINC FINGER HOMEODOMAIN 3, ZIN... Lus10038135 1.4 0.9880
AT5G51560 Leucine-rich repeat protein ki... Lus10031703 1.4 0.9873
AT3G21090 ABCG15 ATP-binding cassette G15, ABC-... Lus10009960 2.4 0.9775
AT3G06520 agenet domain-containing prote... Lus10017088 3.0 0.9741
AT1G68480 C2H2ZnF JAG JAGGED, C2H2 and C2HC zinc fin... Lus10041443 3.0 0.9848
AT2G35640 Trihelix Homeodomain-like superfamily p... Lus10040628 3.9 0.9810
AT2G45190 YABBY FIL, YAB1, AFO YABBY1, FILAMENTOUS FLOWER, AB... Lus10032240 5.7 0.9817
AT2G28490 RmlC-like cupins superfamily p... Lus10011364 6.3 0.9729
AT3G02645 Plant protein of unknown funct... Lus10031159 6.3 0.9753
Lus10006724 6.5 0.9764

Lus10018283 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.