Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G10265 46 / 2e-08 Wound-responsive family protein (.1) AT4G10270 45 / 4e-08 Wound-responsive family protein (.1) AT4G05070 42 / 1e-06 Wound-responsive family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10039749 [exp] 110 / 5e-34 AT4G10265 46 / 2e-08 Wound-responsive family protein (.1) Lus10039760 [exp] 43 / 6e-07 AT4G10265 120 / 3e-37 Wound-responsive family protein (.1) Lus10039753 [exp] 43 / 8e-07 AT4G10265 120 / 4e-37 Wound-responsive family protein (.1) Lus10039752 [exp] 41 / 2e-06 AT4G10270 120 / 4e-37 Wound-responsive family protein (.1) Lus10033729 [exp] 41 / 3e-06 AT4G10270 94 / 8e-27 Wound-responsive family protein (.1) Lus10018530 [exp] 41 / 3e-06 AT4G10270 119 / 8e-37 Wound-responsive family protein (.1) Lus10039756 [exp] 41 / 4e-06 AT4G10265 95 / 3e-27 Wound-responsive family protein (.1) Lus10039751 [exp] 40 / 9e-06 AT4G10265 113 / 1e-34 Wound-responsive family protein (.1) Lus10018531 [exp] 39 / 1e-05 AT4G10265 119 / 1e-36 Wound-responsive family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.019G117800 [exp] 62 / 2e-14 AT4G10265 49 / 5e-09 Wound-responsive family protein (.1) Potri.013G148300 [exp] 57 / 8e-13 AT4G10265 49 / 4e-09 Wound-responsive family protein (.1) Potri.013G147900 [exp] 49 / 3e-09 AT4G10270 61 / 2e-13 Wound-responsive family protein (.1) Potri.004G033300 [exp] 48 / 6e-09 AT4G05070 54 / 6e-11 Wound-responsive family protein (.1) Potri.019G117402 [exp] 46 / 3e-08 AT4G10270 97 / 5e-28 Wound-responsive family protein (.1) Potri.019G117500 [exp] 46 / 3e-08 AT4G10270 97 / 5e-28 Wound-responsive family protein (.1) Potri.019G117632 [exp] 46 / 3e-08 AT4G10270 98 / 3e-28 Wound-responsive family protein (.1) Potri.019G117200 [exp] 45 / 5e-08 AT4G10270 79 / 1e-20 Wound-responsive family protein (.1) Potri.019G117201 [exp] 45 / 7e-08 AT4G10270 82 / 5e-22 Wound-responsive family protein (.1) Potri.019G116932 [exp] 45 / 9e-08 AT4G10270 108 / 2e-32 Wound-responsive family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF12609 [flax] [poplar] DUF3774 Wound-induced protein
Representative CDS sequence Show only first row Show all	>Lus10018529 pacid=23180403 polypeptide=Lus10018529 locus=Lus10018529.g ID=Lus10018529.BGIv1.0 annot-version=v1.0 ATGCAGACAGAAGCAGCAGCTACTGAAGACAGTACTAGTACTACTTCGAGGAATGCGAGCAAGAAGCAGAGGATCAGCATCAGAGGAGGGTTCATAAGCT ACAAGGAAGACCCAGCAAGAAGCATCGACGAGTTCAAGCTCAAACAGGCTGAGGAGTCTCTCAGGACTGTCATGTACCTCAGCTGCTGGGGCCCTAACTA A
AA sequence Show only first row Show all	>Lus10018529 pacid=23180403 polypeptide=Lus10018529 locus=Lus10018529.g ID=Lus10018529.BGIv1.0 annot-version=v1.0 MQTEAAATEDSTSTTSRNASKKQRISIRGGFISYKEDPARSIDEFKLKQAEESLRTVMYLSCWGPN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G10265			Wound-responsive family protei...		Lus10018529 [exp]	0	1
AT4G30420			nodulin MtN21 /EamA-like trans...		Lus10019970 [exp]	4.9	0.9471
AT2G23790			Protein of unknown function (D...		Lus10022496 [exp]	7.9	0.9363
AT1G24020		MLP423	MLP-like protein 423 (.1.2)		Lus10029185 [exp]	12.0	0.9066
AT5G37600		ATGLN1;1, GLN1;...	ARABIDOPSIS THALIANA GLUTAMINE...		Lus10012536 [exp]	12.8	0.9288
AT3G16350	MYB		Homeodomain-like superfamily p...		Lus10037560 [exp]	14.7	0.9059
AT1G21400			Thiamin diphosphate-binding fo...		Lus10018945 [exp]	15.2	0.9215
AT4G37870		PCK1, PEPCK	phosphoenolpyruvate carboxykin...		Lus10028227 [exp]	18.1	0.9318
AT1G80160		GLYI7	glyoxylase I 7, Lactoylglutath...		Lus10030070 [exp]	19.0	0.9263
AT1G29680			Protein of unknown function (D...		Lus10005415 [exp]	20.8	0.9138
AT2G19900		ATNADP-ME1	Arabidopsis thaliana NADP-mali...		Lus10012964 [exp]	21.5	0.9207

Compare expression of checked genes

Lus10018529 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.