Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G35350 39 / 0.0002 XCP1 xylem cysteine peptidase 1 (.1.2) AT3G49340 39 / 0.0002 Cysteine proteinases superfamily protein (.1) AT2G34080 39 / 0.0003 Cysteine proteinases superfamily protein (.1) AT2G27420 38 / 0.0004 Cysteine proteinases superfamily protein (.1) AT3G19400 38 / 0.0004 Cysteine proteinases superfamily protein (.1.2) AT3G43960 37 / 0.0007 Cysteine proteinases superfamily protein (.1) AT1G29090 37 / 0.0008 Cysteine proteinases superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002301 [exp] 62 / 2e-12 AT5G45890 397 / 1e-138 senescence-associated gene 12 (.1) Lus10029799 [exp] 60 / 8e-12 AT5G45890 393 / 3e-137 senescence-associated gene 12 (.1) Lus10026073 [exp] 58 / 3e-11 AT5G45890 393 / 5e-137 senescence-associated gene 12 (.1) Lus10032406 [exp] 58 / 4e-11 AT5G45890 391 / 2e-136 senescence-associated gene 12 (.1) Lus10020722 [exp] 57 / 6e-11 AT5G45890 392 / 1e-136 senescence-associated gene 12 (.1) Lus10028501 [exp] 55 / 6e-10 AT5G45890 391 / 2e-136 senescence-associated gene 12 (.1) Lus10028502 [exp] 54 / 7e-10 AT5G45890 394 / 3e-137 senescence-associated gene 12 (.1) Lus10020734 [exp] 54 / 1e-09 AT5G45890 390 / 4e-136 senescence-associated gene 12 (.1) Lus10003275 [exp] 54 / 2e-09 AT5G45890 392 / 1e-136 senescence-associated gene 12 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G075300 [exp] 45 / 8e-07 AT5G45890 406 / 6e-142 senescence-associated gene 12 (.1) Potri.007G076100 [exp] 45 / 1e-06 AT5G45890 411 / 7e-144 senescence-associated gene 12 (.1) Potri.007G075900 [exp] 45 / 1e-06 AT5G45890 411 / 7e-144 senescence-associated gene 12 (.1) Potri.014G024100 [exp] 45 / 2e-06 AT5G43060 646 / 0.0 Granulin repeat cysteine protease family protein (.1) Potri.007G076000 [exp] 44 / 4e-06 AT5G45890 407 / 2e-142 senescence-associated gene 12 (.1) Potri.007G075100 [exp] 43 / 7e-06 AT5G45890 371 / 4e-129 senescence-associated gene 12 (.1) Potri.013G118200 [exp] 42 / 1e-05 AT5G45890 387 / 2e-135 senescence-associated gene 12 (.1) Potri.004G055900 [exp] 42 / 2e-05 AT5G45890 438 / 5e-155 senescence-associated gene 12 (.1) Potri.004G056500 [exp] 42 / 2e-05 AT5G45890 417 / 2e-146 senescence-associated gene 12 (.1) Potri.004G056000 [exp] 42 / 2e-05 AT5G45890 417 / 2e-146 senescence-associated gene 12 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF08246 [flax] [poplar] Inhibitor_I29 Cathepsin propeptide inhibitor domain (I29)
Representative CDS sequence Show only first row Show all	>Lus10018586 pacid=23180413 polypeptide=Lus10018586 locus=Lus10018586.g ID=Lus10018586.BGIv1.0 annot-version=v1.0 ATGAAATCAATCTTTCACTTGTCTTCAATATTGTTGATCCTCCTCTTTGTAGCTGTAACTGATCATCATCAAGCCACGTCGATGACGACAAGCCATGAAG ATCCAATGTCCCCGATGCGCCTCAAATTCGAGGAATGGATGTCCGATTACGAAAAGGTGTACAAGGACGATGAGGAGAAGGAGCATCGGTTCCAGAAATT CAAGCGCGAAGTTGAATTCATCGAGGTTTGGAACGCCGATGAAAATGAGTCGACCACTTGTGGACTCAATCAATGGTCCGATCTAACCAACGAGGAATGA
AA sequence Show only first row Show all	>Lus10018586 pacid=23180413 polypeptide=Lus10018586 locus=Lus10018586.g ID=Lus10018586.BGIv1.0 annot-version=v1.0 MKSIFHLSSILLILLFVAVTDHHQATSMTTSHEDPMSPMRLKFEEWMSDYEKVYKDDEEKEHRFQKFKREVEFIEVWNADENESTTCGLNQWSDLTNEE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G29110			Cysteine proteinases superfami...		Lus10018586 [exp]	0	1
AT5G24230			Lipase class 3-related protein...		Lus10022416 [exp]	3.0	0.7537
AT5G42020		BIP2, BIP	luminal binding protein, Heat ...		Lus10026349 [exp]	8.7	0.7345
AT1G26560		BGLU40	beta glucosidase 40 (.1)		Lus10036885 [exp]	16.7	0.7262
AT2G41480			Peroxidase superfamily protein...		Lus10015555 [exp]	21.7	0.6838
AT3G47570			Leucine-rich repeat protein ki...		Lus10004388 [exp]	22.8	0.6756
AT1G12740		CYP87A2	"cytochrome P450, family 87, s...		Lus10028628 [exp]	25.5	0.6595
AT2G33670		ATMLO5, MLO5	MILDEW RESISTANCE LOCUS O 5, S...		Lus10030729 [exp]	28.7	0.5940
AT1G76390		PUB43	plant U-box 43, ARM repeat sup...		Lus10039402 [exp]	32.3	0.6812
AT1G03220			Eukaryotic aspartyl protease f...		Lus10041225 [exp]	34.9	0.6671
					Lus10026392 [exp]	35.5	0.6583

Compare expression of checked genes

Lus10018586 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.