Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G096200 [exp] 54 / 1e-10 AT1G78172 / unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10018607 pacid=23180370 polypeptide=Lus10018607 locus=Lus10018607.g ID=Lus10018607.BGIv1.0 annot-version=v1.0 ATGGACGGCGTAGCGTCACCGACGGCGAAATTAGTTCTCGCTATCCGCTGCGCCAAAGCAGCTATGCTAGTTTCGTCGCTGAAGCATGCAGTCGTCGTCG AGCGGGTTGTATCCCCGGGAGAAGAAGAGGATGAGACGACGATGAAGGAAATCCGAGATCTGAGGTTGAAATTGGCGAGAGAGAGGTTCAGGAGCAGCCA GATTCAACTGTGTGGATCGGTGGAGCTGGCGATCCTTGTTACGTTCCTGTTCATGTTTCTTGCAGCTCTAATCCTTCTGTTCAAGCTCGTCCCTCTTGCC AGATGCATCTGTGTGGATCGGTGGAGCTGA
AA sequence Show only first row Show all	>Lus10018607 pacid=23180370 polypeptide=Lus10018607 locus=Lus10018607.g ID=Lus10018607.BGIv1.0 annot-version=v1.0 MDGVASPTAKLVLAIRCAKAAMLVSSLKHAVVVERVVSPGEEEDETTMKEIRDLRLKLARERFRSSQIQLCGSVELAILVTFLFMFLAALILLFKLVPLA RCICVDRWS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10018607 [exp]	0	1
AT1G47740			PPPDE putative thiol peptidase...		Lus10032708 [exp]	16.6	0.7743
AT1G09795		HISN1B, ATATP-P...	ATP phosphoribosyl transferase...		Lus10028993 [exp]	16.6	0.7974
AT1G15390		PDF1A, ATDEF1	peptide deformylase 1A (.1)		Lus10011493 [exp]	22.1	0.7977
AT1G55205			unknown protein		Lus10023655 [exp]	26.3	0.7319
AT5G51140			Pseudouridine synthase family ...		Lus10022437 [exp]	27.8	0.7853
AT5G20060			alpha/beta-Hydrolases superfam...		Lus10019438 [exp]	36.6	0.7663
AT5G55220			trigger factor type chaperone ...		Lus10000783 [exp]	36.6	0.7563
AT5G28750			Bacterial sec-independent tran...		Lus10015910 [exp]	39.2	0.7663
AT5G55280		ATFTSZ1-1, CPFT...	CHLOROPLAST FTSZ, ARABIDOPSIS ...		Lus10002442 [exp]	45.8	0.7714
AT1G68730			Zim17-type zinc finger protein...		Lus10019154 [exp]	48.9	0.7494

Compare expression of checked genes

Lus10018607 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.