Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G27460 184 / 8e-56 NPGR1 no pollen germination related 1 (.1) AT4G28600 106 / 1e-27 NPGR2 no pollen germination related 2 (.1) AT2G43040 82 / 4e-19 NPG1 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007743 [exp] 151 / 7e-47 AT4G28600 149 / 2e-41 no pollen germination related 2 (.1) Lus10011793 [exp] 114 / 2e-30 AT4G28600 751 / 0.0 no pollen germination related 2 (.1) Lus10023748 [exp] 112 / 1e-29 AT4G28600 753 / 0.0 no pollen germination related 2 (.1) Lus10017638 [exp] 82 / 5e-19 AT2G43040 929 / 0.0 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1) Lus10008236 [exp] 78 / 1e-17 AT4G28600 738 / 0.0 no pollen germination related 2 (.1) Lus10033595 [exp] 78 / 2e-17 AT2G43040 926 / 0.0 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1) Lus10029803 [exp] 75 / 1e-16 AT2G43040 934 / 0.0 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1) Lus10020725 [exp] 75 / 1e-16 AT2G43040 934 / 0.0 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1) Lus10022897 [exp] 73 / 7e-16 AT4G28600 736 / 0.0 no pollen germination related 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G118500 [exp] 196 / 6e-60 AT1G27460 868 / 0.0 no pollen germination related 1 (.1) Potri.014G016000 [exp] 190 / 5e-58 AT1G27460 841 / 0.0 no pollen germination related 1 (.1) Potri.010G068700 [exp] 112 / 1e-29 AT4G28600 708 / 0.0 no pollen germination related 2 (.1) Potri.008G169500 [exp] 105 / 2e-27 AT4G28600 699 / 0.0 no pollen germination related 2 (.1) Potri.002G055200 [exp] 86 / 3e-20 AT2G43040 1035 / 0.0 no pollen germination 1, tetratricopeptide repeat (TPR)-containing protein (.1) Potri.002G259300 [exp] 75 / 1e-16 AT4G28600 751 / 0.0 no pollen germination related 2 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10018679 pacid=23176258 polypeptide=Lus10018679 locus=Lus10018679.g ID=Lus10018679.BGIv1.0 annot-version=v1.0 ATGTTGTGTGCTTGCTCCGGGGAGCAGTTCAAATTTGAGGAGGCGCCGCCGTCGCCGGTTTCTCTGGCCACAAGAGATTTCTCAGTCAGCGGACTGTCTT CCAGGACAACCGGCGACTGGGACTCCAAACTTGAGGATATCCAGGTGGATGAAGCTGAATCCACTCTTAAAGAGGCTCTCTCCTTGAATTATGAGGAAGC AAGAGCGTTACTGGGCAGGCTGGAGTACCAGAAAGGCAACTTTGATGCAGCTCTTCAGGTTTTCCAAGGAATTGACATCAGAGGCTTGAAGGCCAAAATG ATCAGAGCTATTATTGGAAGAACTCATCAGCCTCCAAGGAAGCCTCGATCCAAAGGTGGTGAAGCCTCGATCCAAAGGTGGTGA
AA sequence Show only first row Show all	>Lus10018679 pacid=23176258 polypeptide=Lus10018679 locus=Lus10018679.g ID=Lus10018679.BGIv1.0 annot-version=v1.0 MLCACSGEQFKFEEAPPSPVSLATRDFSVSGLSSRTTGDWDSKLEDIQVDEAESTLKEALSLNYEEARALLGRLEYQKGNFDAALQVFQGIDIRGLKAKM IRAIIGRTHQPPRKPRSKGGEASIQRW

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G27460		NPGR1	no pollen germination related ...		Lus10018679 [exp]	0	1
AT1G27460		NPGR1	no pollen germination related ...		Lus10018678 [exp]	1.0	0.8775
AT5G60370			unknown protein		Lus10023343 [exp]	5.5	0.8577
AT4G28780			GDSL-like Lipase/Acylhydrolase...		Lus10004770 [exp]	7.7	0.8534
AT3G24495		ATMSH7, MSH7, M...	MUTS HOMOLOG 6-2, ARABIDOPSIS ...		Lus10033095 [exp]	8.5	0.8361
AT4G34380			Transducin/WD40 repeat-like su...		Lus10038296 [exp]	13.4	0.8470
AT5G01460			LMBR1-like membrane protein (....		Lus10004814 [exp]	14.7	0.8326
AT1G06520		ATGPAT1, GPAT1	glycerol-3-phosphate acyltrans...		Lus10031396 [exp]	23.3	0.7614
AT1G73360	HD	ATHDG11, HDG11,...	ENHANCED DROUGHT TOLERANCE 1, ...		Lus10031321 [exp]	29.7	0.8381
AT5G58130		ROS3	REPRESSOR OF SILENCING 3, RNA-...		Lus10040568 [exp]	32.9	0.8183
AT4G39490		CYP96A10	"cytochrome P450, family 96, s...		Lus10022277 [exp]	33.3	0.8239

Compare expression of checked genes

Lus10018679 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.