Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G38870 90 / 1e-25 Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT5G43580 76 / 1e-19 UPI UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT2G38900 75 / 1e-19 Serine protease inhibitor, potato inhibitor I-type family protein (.1.2) AT3G46860 57 / 2e-12 Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT5G43570 49 / 2e-09 Serine protease inhibitor, potato inhibitor I-type family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018783 [exp] 108 / 4e-33 AT2G38870 89 / 2e-25 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10018786 [exp] 99 / 3e-29 AT2G38870 93 / 6e-27 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10024870 [exp] 96 / 4e-28 AT2G38870 94 / 2e-27 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10014740 [exp] 83 / 6e-23 AT2G38870 77 / 2e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10002732 [exp] 76 / 4e-20 AT2G38870 76 / 4e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10032655 [exp] 57 / 2e-11 AT1G52870 499 / 3e-176 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.1), Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.2) Lus10043097 [exp] 56 / 6e-11 AT1G52870 505 / 2e-179 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.1), Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.2) Lus10024370 [exp] 46 / 4e-08 AT2G38870 47 / 3e-08 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10010859 [exp] 46 / 5e-08 AT2G38900 47 / 3e-08 Serine protease inhibitor, potato inhibitor I-type family protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G075600 [exp] 95 / 1e-27 AT5G43580 80 / 3e-21 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075200 [exp] 91 / 5e-26 AT2G38870 76 / 4e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.006G212000 [exp] 91 / 6e-26 AT2G38870 81 / 5e-22 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075400 [exp] 90 / 1e-25 AT2G38870 84 / 3e-23 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.016G078800 [exp] 88 / 8e-25 AT2G38870 79 / 3e-21 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.016G079050 [exp] 86 / 4e-24 AT2G38870 81 / 2e-22 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.006G212200 [exp] 84 / 1e-23 AT2G38870 81 / 6e-22 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.016G078900 [exp] 84 / 2e-23 AT2G38870 84 / 2e-23 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.009G028300 [exp] 84 / 3e-23 AT5G43580 76 / 7e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075800 [exp] 84 / 3e-23 AT2G38870 76 / 3e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0367 [flax] [poplar] CI-2 PF00280 [flax] [poplar] potato_inhibit Potato inhibitor I family
Representative CDS sequence Show only first row Show all	>Lus10018784 pacid=23176292 polypeptide=Lus10018784 locus=Lus10018784.g ID=Lus10018784.BGIv1.0 annot-version=v1.0 ATGTCGACTGACTGTTCAGGTAAGAACTCATGGCCGGAGCTGTTGGCGACCAACGGGGACGCGGCGGCGGCAGTCGTTGAGAGGGAGAACGACAACGTTG ATGCGATCGTGGTGCTGGAAGGGACGATCGTTCCCCTAGATTTCAGGTGTAACCGGGTTTGGGTTTGGGTTGATGCCAATAGGGTTGTCACCCGTGTTCC TACCGTTGGTTGA
AA sequence Show only first row Show all	>Lus10018784 pacid=23176292 polypeptide=Lus10018784 locus=Lus10018784.g ID=Lus10018784.BGIv1.0 annot-version=v1.0 MSTDCSGKNSWPELLATNGDAAAAVVERENDNVDAIVVLEGTIVPLDFRCNRVWVWVDANRVVTRVPTVG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G38870			Serine protease inhibitor, pot...		Lus10018784 [exp]	0	1
AT5G24550		BGLU32	beta glucosidase 32 (.1)		Lus10024152 [exp]	1.4	0.8808
AT5G39110			RmlC-like cupins superfamily p...		Lus10035293 [exp]	5.0	0.8179
AT3G45140		ATLOX2, LOX2	ARABIODOPSIS THALIANA LIPOXYGE...		Lus10031237 [exp]	7.3	0.8486
AT1G17420		ATLOX3, LOX3	Arabidopsis thaliana lipoxygen...		Lus10031239 [exp]	10.9	0.7909
					Lus10036864 [exp]	12.8	0.8047
AT1G73260		ATKTI1	ARABIDOPSIS THALIANA KUNITZ TR...		Lus10029429 [exp]	12.9	0.8765
AT3G57270		BG1	"beta-1,3-glucanase 1", beta-1...		Lus10019801 [exp]	15.5	0.8166
AT2G38870			Serine protease inhibitor, pot...		Lus10024870 [exp]	17.7	0.8357
AT3G45140		ATLOX2, LOX2	ARABIODOPSIS THALIANA LIPOXYGE...		Lus10031238 [exp]	28.3	0.7574
AT5G06720		ATPA2	peroxidase 2 (.1)		Lus10008167 [exp]	34.9	0.7828

Compare expression of checked genes

Lus10018784 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.