Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G02370 42 / 5e-06 Protein of unknown function, DUF538 (.1) AT1G02816 41 / 2e-05 Protein of unknown function, DUF538 (.1) AT4G02360 36 / 0.001 Protein of unknown function, DUF538 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10009855 [exp] 43 / 3e-06 AT1G02816 169 / 2e-54 Protein of unknown function, DUF538 (.1) Lus10009854 [exp] 0 / 1 AT1G02816 184 / 3e-60 Protein of unknown function, DUF538 (.1) Lus10010297 [exp] 0 / 1 AT1G02816 184 / 4e-60 Protein of unknown function, DUF538 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G203400 [exp] 51 / 2e-09 AT1G02816 211 / 6e-71 Protein of unknown function, DUF538 (.1) Potri.014G127600 [exp] 51 / 4e-09 AT1G02816 206 / 4e-68 Protein of unknown function, DUF538 (.1) Potri.014G127500 [exp] 44 / 2e-06 AT4G02370 167 / 1e-53 Protein of unknown function, DUF538 (.1) Potri.005G024000 [exp] 42 / 8e-06 AT1G02816 186 / 1e-60 Protein of unknown function, DUF538 (.1) Potri.013G014600 [exp] 38 / 0.0002 AT1G02816 181 / 8e-59 Protein of unknown function, DUF538 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF04398 [flax] [poplar] DUF538 Protein of unknown function, DUF538
Representative CDS sequence Show only first row Show all	>Lus10018818 pacid=23144709 polypeptide=Lus10018818 locus=Lus10018818.g ID=Lus10018818.BGIv1.0 annot-version=v1.0 ATGTCTCCGTCGGCGTCGCTTTTTCTCTTCTTCTCCTTCCTCATCGTAAAACCTTCCCCTCCGGCCGCCGCGGAAGCACTATCGGCGTACGAAGTCCTCG AAGGATACAACTTCCCGATCGGCCTCCTTCCACGGGGAGCAACCGGATATGAACTCGACCCGTTCACGGGAGATTCCGCACTTATCTCCACGGAAGCTGC AGCTTCTCCAGCTGCTGTACCAGCTGAAATACAGCTCCGTAATCGGCGGATAACTCAGCGAGAATCGGCTCACTAA
AA sequence Show only first row Show all	>Lus10018818 pacid=23144709 polypeptide=Lus10018818 locus=Lus10018818.g ID=Lus10018818.BGIv1.0 annot-version=v1.0 MSPSASLFLFFSFLIVKPSPPAAAEALSAYEVLEGYNFPIGLLPRGATGYELDPFTGDSALISTEAAASPAAVPAEIQLRNRRITQRESAH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G02816			Protein of unknown function, D...		Lus10018818 [exp]	0	1
AT5G01110			Tetratricopeptide repeat (TPR)...		Lus10028944 [exp]	11.0	0.6481
AT1G68490			unknown protein		Lus10027557 [exp]	13.1	0.7167
AT2G36960	MYB	TKI1	TSL-kinase interacting protein...		Lus10010230 [exp]	19.0	0.6993
AT1G47890		AtRLP7	receptor like protein 7 (.1)		Lus10004309 [exp]	21.0	0.6849
AT4G03230			S-locus lectin protein kinase ...		Lus10033752 [exp]	22.1	0.6801
AT5G11340			Acyl-CoA N-acyltransferases (N...		Lus10008088 [exp]	26.5	0.6781
AT1G22620		ATSAC1	suppressor of actin 1, Phospho...		Lus10016941 [exp]	27.5	0.6979
AT1G07360	C3HZnF	MAC5A	MOS4-associated complex subuni...		Lus10012448 [exp]	40.0	0.6299
AT4G24190		AtHsp90-7, HSP9...	SHEPHERD, HEAT SHOCK PROTEIN 9...		Lus10035109 [exp]	45.4	0.6729
AT1G13310			Endosomal targeting BRO1-like ...		Lus10041484 [exp]	45.5	0.6529

Compare expression of checked genes

Lus10018818 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.