Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G14760 96 / 2e-24 AO L-aspartate oxidase (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10014539 [exp] 102 / 7e-27 AT5G14760 994 / 0.0 L-aspartate oxidase (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G348600 [exp] 100 / 4e-26 AT5G14760 996 / 0.0 L-aspartate oxidase (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0063 [flax] [poplar] NADP_Rossmann PF00890 [flax] [poplar] FAD_binding_2 FAD binding domain
Representative CDS sequence Show only first row Show all	>Lus10018901 pacid=23144769 polypeptide=Lus10018901 locus=Lus10018901.g ID=Lus10018901.BGIv1.0 annot-version=v1.0 ATGGCCAAGGCTGAGCCTCACGAGAGCAACACAAATTATGCCCAAGGCGGTGTTAGTGCCGTCTTGTGTCCAACAGACTCTGTCGAGAGTCACATGCAGG ACACAATTGTAGCCGGTGCGTATCTATGCGATGAGGAGACTGTTAGGGTAAGGGATGGTCCTGACACAGTTTGCCATGGTATTGATACTTTGAGCACTGA AACACAAGAGGTAACTGTGGAGGGGCTTTGGTTTTCTAAACTTGCTCTCCTGGAATCTTATGGATTTTAA
AA sequence Show only first row Show all	>Lus10018901 pacid=23144769 polypeptide=Lus10018901 locus=Lus10018901.g ID=Lus10018901.BGIv1.0 annot-version=v1.0 MAKAEPHESNTNYAQGGVSAVLCPTDSVESHMQDTIVAGAYLCDEETVRVRDGPDTVCHGIDTLSTETQEVTVEGLWFSKLALLESYGF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G14760		AO	L-aspartate oxidase (.1)		Lus10018901 [exp]	0	1
					Lus10003831 [exp]	1.7	1.0000
AT5G64790			O-Glycosyl hydrolases family 1...		Lus10005788 [exp]	2.4	1.0000
					Lus10006010 [exp]	3.0	1.0000
					Lus10010840 [exp]	3.5	1.0000
					Lus10023520 [exp]	3.9	1.0000
					Lus10026042 [exp]	4.2	1.0000
					Lus10012669 [exp]	4.9	1.0000
					Lus10013504 [exp]	5.2	1.0000
					Lus10015681 [exp]	5.7	1.0000
					Lus10032814 [exp]	6.0	1.0000

Compare expression of checked genes

Lus10018901 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.