Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G53130 71 / 2e-16 ATCNGC1, CNGC1 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) AT1G01340 52 / 1e-09 ACBK1, ATCNGC10 cyclic nucleotide gated channel 10 (.1.2) AT2G46430 48 / 4e-08 CNGC3.C, ATCNGC3 cyclic nucleotide gated channel 3 (.1.2) AT4G01010 43 / 2e-06 ATCNGC13 cyclic nucleotide-gated channel 13 (.1) AT5G57940 38 / 0.0002 ATCNGC5 cyclic nucleotide gated channel 5 (.1.2.3) AT2G24610 37 / 0.0003 ATCNGC14 cyclic nucleotide-gated channel 14 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10003395 [exp] 128 / 3e-36 AT5G53130 1117 / 0.0 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) Lus10019014 [exp] 101 / 6e-27 AT5G53130 1122 / 0.0 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) Lus10036260 [exp] 47 / 8e-08 AT4G30560 1102 / 0.0 cyclic nucleotide gated channel 9 (.1.2) Lus10024073 [exp] 43 / 2e-06 AT1G19780 1033 / 0.0 cyclic nucleotide gated channel 8 (.1) Lus10041662 [exp] 42 / 5e-06 AT1G19780 1056 / 0.0 cyclic nucleotide gated channel 8 (.1) Lus10014925 [exp] 42 / 8e-06 AT5G53130 1031 / 0.0 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) Lus10019983 [exp] 38 / 0.0002 AT4G30360 1000 / 0.0 cyclic nucleotide-gated channel 17 (.1) Lus10015510 [exp] 38 / 0.0002 AT4G30360 1004 / 0.0 cyclic nucleotide-gated channel 17 (.1) Lus10023203 [exp] 36 / 0.001 AT4G30360 1002 / 0.0 cyclic nucleotide-gated channel 17 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G019100 [exp] 89 / 2e-22 AT5G53130 1024 / 0.0 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) Potri.012G002200 [exp] 87 / 9e-22 AT5G53130 1087 / 0.0 CYCLIC NUCLEOTIDE-GATED CHANNEL 1, cyclic nucleotide gated channel 1 (.1) Potri.014G097900 [exp] 61 / 1e-12 AT1G01340 901 / 0.0 cyclic nucleotide gated channel 10 (.1.2) Potri.002G170000 [exp] 59 / 5e-12 AT1G01340 909 / 0.0 cyclic nucleotide gated channel 10 (.1.2) Potri.018G106100 [exp] 46 / 2e-07 AT5G57940 1030 / 0.0 cyclic nucleotide gated channel 5 (.1.2.3) Potri.003G183000 [exp] 37 / 0.0003 AT1G19780 893 / 0.0 cyclic nucleotide gated channel 8 (.1) Potri.006G271480 [exp] 37 / 0.0005 AT2G24610 493 / 2e-171 cyclic nucleotide-gated channel 14 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10019015 pacid=23152655 polypeptide=Lus10019015 locus=Lus10019015.g ID=Lus10019015.BGIv1.0 annot-version=v1.0 ATGAGGCAAAAAGAGGACAGACTACAGGATGCACTGGCTAAGGCGAGCTTTAACGGGAACTCTCCTAGCTTTGGTGCAACTATATACGCGTCGAGGTTTG CTGTTAATGTGCTAGGACTACAGAGGAGGAACTCAACTCGAAAGACGAGTGTTCCTCCCAGGTTGTTGCAGAAGCCAGCTGAGCCGGATTTTACTGCTCA TGAACGGTAG
AA sequence Show only first row Show all	>Lus10019015 pacid=23152655 polypeptide=Lus10019015 locus=Lus10019015.g ID=Lus10019015.BGIv1.0 annot-version=v1.0 MRQKEDRLQDALAKASFNGNSPSFGATIYASRFAVNVLGLQRRNSTRKTSVPPRLLQKPAEPDFTAHER

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G53130		ATCNGC1, CNGC1	CYCLIC NUCLEOTIDE-GATED CHANNE...		Lus10019015 [exp]	0	1
AT3G29635			HXXXD-type acyl-transferase fa...		Lus10005362 [exp]	15.7	0.8853
AT2G29420		GST25, ATGSTU7	GLUTATHIONE S-TRANSFERASE 25, ...		Lus10016470 [exp]	20.9	0.8806
					Lus10038520 [exp]	21.3	0.8832
AT5G01650			Tautomerase/MIF superfamily pr...		Lus10012223 [exp]	26.7	0.8773
AT5G09680		RLF	reduced lateral root formation...		Lus10039342 [exp]	27.8	0.8824
AT2G29420		GST25, ATGSTU7	GLUTATHIONE S-TRANSFERASE 25, ...		Lus10016469 [exp]	30.2	0.8787
AT1G27900			RNA helicase family protein (....		Lus10015812 [exp]	31.5	0.8722
AT3G23880			F-box and associated interacti...		Lus10036065 [exp]	37.3	0.8598
AT5G58040		FIP1[V], ATFIP1...	homolog of yeast FIP1 [V], hom...		Lus10040031 [exp]	38.5	0.8570
AT4G14640		CAM8, AtCML8	calmodulin-like 8, calmodulin ...		Lus10014709 [exp]	42.1	0.8742

Compare expression of checked genes

Lus10019015 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.