Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10043318 [exp] 64 / 1e-14 AT5G50175 49 / 1e-08 unknown protein
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10019469 pacid=23181490 polypeptide=Lus10019469 locus=Lus10019469.g ID=Lus10019469.BGIv1.0 annot-version=v1.0 ATGACGCCGCCGGCCTCTCTCGGACCCAAATCACTGACCTCCAGCGCCACCGCGATTCTGCTGCTCTTCTCTGTCTCACTACTTGCTCTACCCGCTCTGA CTGTCAGTAGCACTGCGGCCTACTGGCCCGATTTACCTCGCTCCTTCCTCCTCATCGCTGCTTTCGTTTTGGCTTCCTTGTTCGTCGTCGTTGCCGCAAG AGCTGCCATGGTCACTTGGATTACTCTGCTAGTGCTGTTAACCTTCGCCGGCAACCGCCGCCGTGTTCTCGTTCAGCACCGCCGGCGCATAACCACTGAC GTCCTCCTCAACCTGTTTAAATGCGCCGCCTCCTAG
AA sequence Show only first row Show all	>Lus10019469 pacid=23181490 polypeptide=Lus10019469 locus=Lus10019469.g ID=Lus10019469.BGIv1.0 annot-version=v1.0 MTPPASLGPKSLTSSATAILLLFSVSLLALPALTVSSTAAYWPDLPRSFLLIAAFVLASLFVVVAARAAMVTWITLLVLLTFAGNRRRVLVQHRRRITTD VLLNLFKCAAS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G50175			unknown protein		Lus10019469 [exp]	0	1
AT5G50175			unknown protein		Lus10043318 [exp]	1.0	0.9487
AT3G51680		AtSDR2	short-chain dehydrogenase/redu...		Lus10029438 [exp]	1.4	0.8962
AT4G35160			O-methyltransferase family pro...		Lus10001510 [exp]	1.7	0.8820
AT2G42250		CYP712A1	"cytochrome P450, family 712, ...		Lus10023827 [exp]	4.9	0.8607
AT4G34660			SH3 domain-containing protein ...		Lus10028784 [exp]	6.5	0.7616
AT2G26980		CIPK3, SnRK3.17	SNF1-RELATED PROTEIN KINASE 3....		Lus10022590 [exp]	7.1	0.8651
AT4G17486			PPPDE putative thiol peptidase...		Lus10043293 [exp]	7.3	0.8306
AT4G14640		CAM8, AtCML8	calmodulin-like 8, calmodulin ...		Lus10041179 [exp]	8.4	0.8278
AT2G47485			unknown protein		Lus10028487 [exp]	11.2	0.8517
AT3G51840		ATG6, ATSCX, AC...	acyl-CoA oxidase 4 (.1)		Lus10027811 [exp]	12.4	0.7751

Compare expression of checked genes

Lus10019469 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.