Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10006897 [exp] 61 / 1e-13 ND / Lus10017955 [exp] 60 / 2e-13 ND / Lus10041944 [exp] 56 / 6e-12 ND / Lus10017954 [exp] 53 / 1e-10 ND / Lus10041943 [exp] 48 / 2e-08 ND / Lus10041941 [exp] 42 / 2e-06 ND /
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G085901 [exp] 84 / 1e-22 ND / Potri.012G085800 [exp] 75 / 1e-18 ND / Potri.012G086200 [exp] 52 / 4e-10 ND / Potri.015G084101 [exp] 47 / 4e-08 ND /
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10019472 pacid=23181595 polypeptide=Lus10019472 locus=Lus10019472.g ID=Lus10019472.BGIv1.0 annot-version=v1.0 ATGGAGGGCAGAAACAATAGCCATGATGACTACCATGCCCACATCTCGACGATTATGCATACTCCCAGTCTTATCCACGGCGTGCCTCACTATCCAAACG TCCACAAGGCCAAGAAGCGAGTTCAGTTGATGGATCATCACCAACAGAAAGCTATTAATAATGAAACCAGCACCAGCAGTGTGAAAACTACTGGTGTTGA TTCTGAAGCTGAAGGGTTCATCCAGCAGAAGCGTAAGGGTTTCGAGTTATGCAAATGGAAGACCTTCAGGCTCTGA
AA sequence Show only first row Show all	>Lus10019472 pacid=23181595 polypeptide=Lus10019472 locus=Lus10019472.g ID=Lus10019472.BGIv1.0 annot-version=v1.0 MEGRNNSHDDYHAHISTIMHTPSLIHGVPHYPNVHKAKKRVQLMDHHQQKAINNETSTSSVKTTGVDSEAEGFIQQKRKGFELCKWKTFRL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10019472 [exp]	0	1
AT3G04030	GARP		Homeodomain-like superfamily p...		Lus10020264 [exp]	1.0	0.9836
AT3G04030	GARP		Homeodomain-like superfamily p...		Lus10002629 [exp]	2.4	0.9670
AT4G37445			unknown protein		Lus10001408 [exp]	4.0	0.9682
					Lus10035048 [exp]	6.0	0.9662
AT3G03490		AtPEX19-1, PEX1...	peroxin 19-1 (.1)		Lus10003813 [exp]	6.6	0.9043
					Lus10035062 [exp]	6.7	0.9615
AT4G16400			unknown protein		Lus10038791 [exp]	7.0	0.9603
					Lus10002859 [exp]	8.5	0.9605
AT2G23970			Class I glutamine amidotransfe...		Lus10019964 [exp]	8.5	0.9599
AT1G75250	MYB	RSM3, ATRL6	RADIALIS-LIKE SANT/MYB 3, RAD-...		Lus10033212 [exp]	9.0	0.9550

Compare expression of checked genes

Lus10019472 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.