Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10016381 [exp] 205 / 3e-70 ND 37 / 0.002 Lus10027634 [exp] 40 / 0.0001 AT5G48030 494 / 8e-174 gametophytic factor 2 (.1) Lus10011934 [exp] 39 / 0.0003 AT5G48030 499 / 8e-176 gametophytic factor 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G137900 [exp] 174 / 6e-58 ND /
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10019742 pacid=23139242 polypeptide=Lus10019742 locus=Lus10019742.g ID=Lus10019742.BGIv1.0 annot-version=v1.0 ATGATTCCTAAGCCAATTCGACCGTTGGTAAAGACCGCCGCTTTCATCGTCGGCGGCTTGGTTGCTATCAATGTCACTTCTACCCTCGCCGTCAGCGCCC TCCGCCACGCCACTGATCTCAAACGGAGAAAAGTTGCATTGCCATGTGGGGTTTGCCGCGGGAAAGGGTTCTACATATGCAAGCTCTGCAAAGGAAATGC CACCATAGAAGAATGGTCTCCTCTGTACGACCCTGTCGCCATGAATCCTTGCCTCTGCCCTACTTGTGATGGAAATAGAGTCCAGCGATGTTTGAACTGT ATTGGCAAAGGCTACAGTTGA
AA sequence Show only first row Show all	>Lus10019742 pacid=23139242 polypeptide=Lus10019742 locus=Lus10019742.g ID=Lus10019742.BGIv1.0 annot-version=v1.0 MIPKPIRPLVKTAAFIVGGLVAINVTSTLAVSALRHATDLKRRKVALPCGVCRGKGFYICKLCKGNATIEEWSPLYDPVAMNPCLCPTCDGNRVQRCLNC IGKGYS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10019742 [exp]	0	1
AT1G70820			phosphoglucomutase, putative /...		Lus10009327 [exp]	29.7	0.7357
AT2G02450	NAC	LOV1, ANAC034, ...	LONG VEGETATIVE PHASE 1, Arabi...		Lus10008420 [exp]	33.9	0.6930
AT5G52780			Protein of unknown function (D...		Lus10038849 [exp]	62.8	0.6917
AT3G27030			unknown protein		Lus10041551 [exp]	73.3	0.6637
AT3G03550			RING/U-box superfamily protein...		Lus10035677 [exp]	141.0	0.6509
AT5G51920			Pyridoxal phosphate (PLP)-depe...		Lus10006342 [exp]	141.4	0.6330
AT4G34880			Amidase family protein (.1)		Lus10025066 [exp]	173.6	0.6134
AT5G22900		ATCHX3	cation/H+ exchanger 3, ARABIDO...		Lus10000154 [exp]	246.8	0.6079

Compare expression of checked genes

Lus10019742 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.