Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10032998 [exp] 77 / 3e-18 AT3G29200 359 / 2e-124 ARABIDOPSIS THALIANA CHORISMATE MUTASE 1, chorismate mutase 1 (.1) Lus10015378 [exp] 54 / 7e-10 AT3G29185 474 / 2e-162 Domain of unknown function (DUF3598) (.1), Domain of unknown function (DUF3598) (.2)
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10019796 pacid=23164095 polypeptide=Lus10019796 locus=Lus10019796.g ID=Lus10019796.BGIv1.0 annot-version=v1.0 ATGGAGGCCAAACTTCTGATGAGAGCTTCCCCTTCTACTGCAATTCATTCTCCTACTACTCATCCTGCCTCCAAGTTGCCTGTTCGATTGATCTGCCGTC TTTCTCCGCTTCCTTCTTCATCAAATCTTGCCAAGTGCGGCATCATCCTCTGCGCAAAGTCTTCTCCTGCCCTGAAGATCAAGAAAGAAAGGGTTGATGA CAGTGAAACTTTGGCACTAGATAGCGTAGGCGCTCCTTGA
AA sequence Show only first row Show all	>Lus10019796 pacid=23164095 polypeptide=Lus10019796 locus=Lus10019796.g ID=Lus10019796.BGIv1.0 annot-version=v1.0 MEAKLLMRASPSTAIHSPTTHPASKLPVRLICRLSPLPSSSNLAKCGIILCAKSSPALKIKKERVDDSETLALDSVGAP

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10019796 [exp]	0	1
AT5G52450			MATE efflux family protein (.1...		Lus10017949 [exp]	1.4	0.8567
AT2G31390		STH	pfkB-like carbohydrate kinase ...		Lus10039195 [exp]	2.2	0.8585
AT5G59190			subtilase family protein (.1)		Lus10000018 [exp]	6.3	0.7719
AT5G22460			alpha/beta-Hydrolases superfam...		Lus10020604 [exp]	15.9	0.8326
AT4G20270		BAM3	BARELY ANY MERISTEM 3, Leucine...		Lus10043327 [exp]	21.2	0.7696
AT4G21330	bHLH	bHLH022, DYT1	DYSFUNCTIONAL TAPETUM 1, basic...		Lus10018395 [exp]	23.5	0.7382
AT3G54490		RPB5E	"RNA polymerase II fifth large...		Lus10039554 [exp]	23.7	0.7669
AT5G15490		UGD3	UDP-glucose dehydrogenase 3, U...		Lus10004657 [exp]	24.0	0.7565
AT1G17180		ATGSTU25	glutathione S-transferase TAU ...		Lus10030020 [exp]	24.7	0.7744
AT3G20640	bHLH	bHLH123	basic helix-loop-helix (bHLH) ...		Lus10038550 [exp]	24.8	0.7975

Compare expression of checked genes

Lus10019796 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.