Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G19400 80 / 1e-19 Cysteine proteinases superfamily protein (.1.2) AT3G19390 79 / 2e-18 Granulin repeat cysteine protease family protein (.1) AT3G43960 70 / 2e-15 Cysteine proteinases superfamily protein (.1) AT1G47128 70 / 2e-15 RD21A, RD21 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) AT5G43060 66 / 4e-14 Granulin repeat cysteine protease family protein (.1) AT4G23520 56 / 2e-10 Cysteine proteinases superfamily protein (.1) AT4G11320 44 / 2e-06 Papain family cysteine protease (.1) AT4G11310 44 / 3e-06 RD21A, RD21 Papain family cysteine protease (.1) AT4G35350 41 / 2e-05 XCP1 xylem cysteine peptidase 1 (.1.2) AT4G36880 40 / 6e-05 CP1 cysteine proteinase1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10014087 [exp] 136 / 2e-39 AT5G43060 622 / 0.0 Granulin repeat cysteine protease family protein (.1) Lus10002827 [exp] 86 / 3e-21 AT1G47128 609 / 0.0 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) Lus10027877 [exp] 85 / 1e-20 AT5G43060 597 / 0.0 Granulin repeat cysteine protease family protein (.1) Lus10024801 [exp] 79 / 1e-18 AT1G47128 633 / 0.0 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) Lus10018735 [exp] 72 / 3e-16 AT1G47128 491 / 3e-172 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) Lus10028501 [exp] 46 / 6e-07 AT5G45890 391 / 2e-136 senescence-associated gene 12 (.1) Lus10029814 [exp] 45 / 9e-07 AT5G45890 145 / 2e-42 senescence-associated gene 12 (.1) Lus10020723 [exp] 45 / 9e-07 AT5G45890 398 / 3e-139 senescence-associated gene 12 (.1) Lus10020734 [exp] 45 / 1e-06 AT5G45890 390 / 4e-136 senescence-associated gene 12 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G302100 [exp] 78 / 3e-18 AT1G47128 598 / 0.0 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) Potri.009G098100 [exp] 75 / 3e-17 AT1G47128 607 / 0.0 RESPONSIVE TO DEHYDRATION 21A, responsive to dehydration 21, Granulin repeat cysteine protease family protein (.1) Potri.014G024100 [exp] 75 / 3e-17 AT5G43060 646 / 0.0 Granulin repeat cysteine protease family protein (.1) Potri.007G047600 [exp] 65 / 1e-13 AT5G43060 461 / 9e-162 Granulin repeat cysteine protease family protein (.1) Potri.005G141600 [exp] 64 / 3e-13 AT4G36880 437 / 1e-153 cysteine proteinase1 (.1) Potri.004G207600 [exp] 47 / 3e-07 AT4G35350 543 / 0.0 xylem cysteine peptidase 1 (.1.2) Potri.013G118400 [exp] 40 / 5e-05 AT5G45890 378 / 2e-131 senescence-associated gene 12 (.1) Potri.013G118200 [exp] 40 / 8e-05 AT5G45890 387 / 2e-135 senescence-associated gene 12 (.1) Potri.005G256000 [exp] 39 / 0.0001 AT1G20850 539 / 0.0 xylem cysteine peptidase 2 (.1) Potri.008G183100 [exp] 39 / 0.0002 AT5G50260 489 / 2e-174 cysteine endopeptidase 1, Cysteine proteinases superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF08246 [flax] [poplar] Inhibitor_I29 Cathepsin propeptide inhibitor domain (I29)
Representative CDS sequence Show only first row Show all	>Lus10019828 pacid=23163950 polypeptide=Lus10019828 locus=Lus10019828.g ID=Lus10019828.BGIv1.0 annot-version=v1.0 ATGGCGTCCCCCTCTTCAACCTCCTTGTTCCTCCTATGTTCCCTCCTTCTCCTAGCTGTTTCCTCCGCCCTAGACATGTCGATCATCGATTACGACGCCC AGCACAACGTTGGCAGTCCGGTTGTTCGTAGCGAGAAGGACCTACGTACGATGTACGAGAGGTGGTTGGTGACGAACCGTAAGAACTACAACGCTCTGGG AGAAAAGGAGAAAAGGTTCGAGATTTTCAAGGAGAACCTGAGGTTCGTCGACGAGCACAACTCCGTCGAGAGGAGTTAA
AA sequence Show only first row Show all	>Lus10019828 pacid=23163950 polypeptide=Lus10019828 locus=Lus10019828.g ID=Lus10019828.BGIv1.0 annot-version=v1.0 MASPSSTSLFLLCSLLLLAVSSALDMSIIDYDAQHNVGSPVVRSEKDLRTMYERWLVTNRKNYNALGEKEKRFEIFKENLRFVDEHNSVERS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G47128		RD21A, RD21	RESPONSIVE TO DEHYDRATION 21A,...		Lus10019828 [exp]	0	1
AT5G43060			Granulin repeat cysteine prote...		Lus10019827 [exp]	4.2	0.8283
AT5G59790			Domain of unknown function (DU...		Lus10040860 [exp]	18.7	0.7917
AT2G23060			Acyl-CoA N-acyltransferases (N...		Lus10025191 [exp]	27.3	0.7447
AT4G02590	bHLH	bHLH059, UNE12	unfertilized embryo sac 12, ba...		Lus10006587 [exp]	32.5	0.7698
AT4G27870			Vacuolar iron transporter (VIT...		Lus10011838 [exp]	33.8	0.8079
AT4G36650		ATPBRP	plant-specific TFIIB-related p...		Lus10041732 [exp]	53.9	0.7810
AT5G15080			Protein kinase superfamily pro...		Lus10030668 [exp]	66.5	0.7672
AT4G36920	AP2_ERF	FL1, FLO2, AP2	FLORAL MUTANT 2, FLOWER 1, APE...		Lus10009374 [exp]	69.4	0.7599
AT2G02090		CHA19, ETL1, CH...	CHROMATIN REMODELING 19, SNF2 ...		Lus10039140 [exp]	72.9	0.7726
AT5G45920			SGNH hydrolase-type esterase s...		Lus10013940 [exp]	85.9	0.7657

Compare expression of checked genes

Lus10019828 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.