Lus10019878 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G33925 170 / 1e-55 SSN2 suppressor of sni1 2, unknown protein
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10014038 55 / 8e-10 AT3G19170 56 / 5e-13 presequence protease 1 (.1.2)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.009G091800 197 / 2e-66 AT4G33925 185 / 9e-62 suppressor of sni1 2, unknown protein
PFAM info
Representative CDS sequence
>Lus10019878 pacid=23164078 polypeptide=Lus10019878 locus=Lus10019878.g ID=Lus10019878.BGIv1.0 annot-version=v1.0
ATGAGCACTACCACATTGGTTGCTGATACTGTGTGGAAAATCATCGAGTCCACTCGTTCAGTCTCAGAGGATCAACTTCGGATATTGCATTTCTTGTTCG
GTAAGAACTTGGAGAGAGCGACGAGAATTGTGGATCAGAAGGGAGTCAAGAGGATTTCTGGTCAACCCAGTGGCCGCTCCATCTTTCAGGTGGTGGGAGA
ATCAAAGAGGCAGGAGGAGTACTTGTGCATCCCTGAAAGCTATTGTGGCTGTTATTCGTTTTTCTACGACAATGTCAACAGAGGAGAACAACTTTTCTGT
AAGCATCAACTTGCTGCAAGGCTTGGTGCAGCATTGGGGTTATGCATTGAAATTAAATTGCCTGACGAGGAACTGGCACAGTTGCTTGCCAAACTCTGA
AA sequence
>Lus10019878 pacid=23164078 polypeptide=Lus10019878 locus=Lus10019878.g ID=Lus10019878.BGIv1.0 annot-version=v1.0
MSTTTLVADTVWKIIESTRSVSEDQLRILHFLFGKNLERATRIVDQKGVKRISGQPSGRSIFQVVGESKRQEEYLCIPESYCGCYSFFYDNVNRGEQLFC
KHQLAARLGAALGLCIEIKLPDEELAQLLAKL

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G33925 SSN2 suppressor of sni1 2, unknown ... Lus10019878 0 1
AT1G67550 URE urease (.1) Lus10036993 1.0 0.9302
AT5G65980 Auxin efflux carrier family pr... Lus10001303 1.4 0.9051
AT4G14570 AtAARE, AARE acylamino acid-releasing enzym... Lus10039405 1.7 0.9036
Lus10041677 2.4 0.8918
AT3G55610 P5CS2 delta 1-pyrroline-5-carboxylat... Lus10001018 3.0 0.8898
AT1G20050 HYD1 HYDRA1, C-8,7 sterol isomerase... Lus10032965 7.5 0.8668
AT3G10910 RING/U-box superfamily protein... Lus10025146 8.5 0.8912
AT1G68910 WIT2 WPP domain-interacting protein... Lus10013053 8.8 0.8818
AT5G10110 unknown protein Lus10022498 9.2 0.8536
AT3G45140 ATLOX2, LOX2 ARABIODOPSIS THALIANA LIPOXYGE... Lus10002547 10.2 0.8481

Lus10019878 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.