Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G61360 115 / 8e-32 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT4G31850 50 / 2e-08 PGR3 proton gradient regulation 3 (.1) AT3G22470 50 / 2e-08 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G14820 49 / 6e-08 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT3G62540 49 / 6e-08 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT2G06000 47 / 2e-07 Pentatricopeptide repeat (PPR) superfamily protein (.1), Pentatricopeptide repeat (PPR) superfamily protein (.2) AT5G39710 47 / 3e-07 EMB2745 EMBRYO DEFECTIVE 2745, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G62470 46 / 5e-07 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G63130 45 / 1e-06 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT5G40400 45 / 1e-06 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001784 [exp] 197 / 2e-62 AT3G61360 490 / 2e-170 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10001633 [exp] 54 / 9e-10 AT1G71060 602 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10003424 [exp] 51 / 1e-08 AT4G31850 1373 / 0.0 proton gradient regulation 3 (.1) Lus10015716 [exp] 50 / 2e-08 AT5G61400 408 / 1e-137 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10041927 [exp] 50 / 2e-08 AT5G18475 341 / 3e-115 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10015741 [exp] 50 / 3e-08 AT3G62470 725 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10001588 [exp] 49 / 5e-08 AT1G77360 679 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10030513 [exp] 49 / 8e-08 AT3G09060 747 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10005540 [exp] 49 / 8e-08 AT5G18475 562 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G130400 [exp] 134 / 2e-38 AT3G61360 540 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.009G105600 [exp] 53 / 2e-09 AT5G39710 1022 / 0.0 EMBRYO DEFECTIVE 2745, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.001G276500 [exp] 50 / 2e-08 AT5G01110 863 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.003G105700 [exp] 50 / 2e-08 AT4G19440 758 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2) Potri.002G103600 [exp] 50 / 2e-08 AT5G18475 546 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.013G047000 [exp] 48 / 8e-08 AT3G04760 781 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.019G019300 [exp] 48 / 9e-08 AT3G04760 776 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.010G217600 [exp] 47 / 2e-07 AT2G16880 677 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.016G111600 [exp] 47 / 2e-07 AT3G09060 860 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.006G242200 [exp] 47 / 4e-07 AT1G62930 472 / 4e-160 RNA processing factor 3, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10020243 pacid=23144059 polypeptide=Lus10020243 locus=Lus10020243.g ID=Lus10020243.BGIv1.0 annot-version=v1.0 ATGGAAGAGAAGCATGTCGGGGTAGATAATGTGACGTACCACACATTGTTCGTAGGGTCGATGAACTCGAGCGGGATAGAAAGTGTCTGCGAGCTGTACG AGAAGATGGTGGCGAAGAGATTCGTTCCGGAAGCGAGGACCTCTGTCATGCTGATGAAGTTCTTCTGCGCAAACGGTAGAATCGACTTCGGGTTGAGGCT ATGGGATTACTTGTTGAGTAATGGACATTGTCCTCACGGACATGCTTTGGATCTTTTGGTGATGGCGCTGTGTTCCAGAGGAAGGTAG
AA sequence Show only first row Show all	>Lus10020243 pacid=23144059 polypeptide=Lus10020243 locus=Lus10020243.g ID=Lus10020243.BGIv1.0 annot-version=v1.0 MEEKHVGVDNVTYHTLFVGSMNSSGIESVCELYEKMVAKRFVPEARTSVMLMKFFCANGRIDFGLRLWDYLLSNGHCPHGHALDLLVMALCSRGR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G61360			Tetratricopeptide repeat (TPR)...		Lus10020243 [exp]	0	1
AT5G62000	ARF	ORE14, HSS, ARF...	ORESARA 14, HLS1 SUPPRESSOR, A...		Lus10040906 [exp]	9.7	0.7880
AT1G66980		GDPDL2, SNC4	Glycerophosphodiester phosphod...		Lus10040037 [exp]	11.0	0.8030
AT3G54320	AP2_ERF	ATWRI1, ASML1, ...	WRINKLED 1, WRINKLED, ACTIVATO...		Lus10036719 [exp]	30.5	0.7705
					Lus10005512 [exp]	43.5	0.6564
AT1G68630			PLAC8 family protein (.1)		Lus10009036 [exp]	43.6	0.7401
AT3G11480		BSMT1, ATBSMT1	S-adenosyl-L-methionine-depend...		Lus10032299 [exp]	63.2	0.7230
					Lus10015230 [exp]	64.0	0.7227
AT3G26880			Plant self-incompatibility pro...		Lus10038164 [exp]	65.9	0.7314
					Lus10002237 [exp]	76.2	0.7158
AT3G03450	GRAS	RGL2	RGA-like 2 (.1)		Lus10016891 [exp]	81.0	0.6480

Compare expression of checked genes

Lus10020243 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.