Lus10020271 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs

No hit found

Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10020271 pacid=23144207 polypeptide=Lus10020271 locus=Lus10020271.g ID=Lus10020271.BGIv1.0 annot-version=v1.0
ATGTCGGGGATCATTCACAAGATCGAGGAGACGCTACACATCGGCGGAGGAGACGATCATAAGGACAAGGACAAAGACAAGCATCACGGTCACGGTGGCG
ATCATAAGCACTCATCCGGCGATCACAAGGAAGGGATCGTCGACAAGATGAAGGACAAGATACACGGCGAAGACCATCATGACCATCACGGCCATGATGG
CGAGAAGAAGAAAAAGAAGAAGAAGGAGAAGAAAAAGCACGAGGACGGGCACGAGAGCAGCAGTGGTAGCGACAGCGACTGA
AA sequence
>Lus10020271 pacid=23144207 polypeptide=Lus10020271 locus=Lus10020271.g ID=Lus10020271.BGIv1.0 annot-version=v1.0
MSGIIHKIEETLHIGGGDDHKDKDKDKHHGHGGDHKHSSGDHKEGIVDKMKDKIHGEDHHDHHGHDGEKKKKKKKEKKKHEDGHESSSGSDSD

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G54410 dehydrin family protein (.1) Lus10020271 0 1
AT4G02160 unknown protein Lus10010018 3.2 0.7780
AT1G32730 unknown protein Lus10011037 4.0 0.7311
AT1G63740 Disease resistance protein (TI... Lus10010546 5.1 0.7578
AT1G14590 Nucleotide-diphospho-sugar tra... Lus10041976 14.3 0.7389
AT1G14200 RING/U-box superfamily protein... Lus10005237 15.3 0.7087
AT1G71120 GLIP6 GDSL-motif lipase/hydrolase 6 ... Lus10034635 16.2 0.7024
Lus10027076 16.9 0.7308
AT3G19300 Protein kinase superfamily pro... Lus10034770 17.7 0.6874
AT3G56960 PIP5K4 phosphatidyl inositol monophos... Lus10010458 18.2 0.6766
AT2G40220 AP2_ERF ATABI4, GIN6, S... SUCROSE UNCOUPLED 6, SUGAR-INS... Lus10009834 21.8 0.7022

Lus10020271 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.