Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G29420 66 / 2e-14 SAUR-like auxin-responsive protein family (.1) AT1G29460 65 / 3e-14 SAUR-like auxin-responsive protein family (.1) AT1G29510 63 / 2e-13 SAUR68 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) AT5G27780 62 / 6e-13 SAUR-like auxin-responsive protein family (.1) AT1G29500 61 / 7e-13 SAUR-like auxin-responsive protein family (.1) AT1G29430 59 / 4e-12 SAUR-like auxin-responsive protein family (.1) AT1G29450 57 / 3e-11 SAUR-like auxin-responsive protein family (.1) AT1G29440 57 / 3e-11 SAUR-like auxin-responsive protein family (.1) AT1G29490 56 / 3e-11 SAUR-like auxin-responsive protein family (.1) AT1G76190 50 / 7e-09 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007066 [exp] 168 / 2e-55 AT1G29430 66 / 5e-15 SAUR-like auxin-responsive protein family (.1) Lus10007067 [exp] 113 / 1e-33 AT1G29430 69 / 4e-16 SAUR-like auxin-responsive protein family (.1) Lus10007069 [exp] 112 / 6e-33 AT1G29430 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10007068 [exp] 108 / 1e-31 AT1G29510 68 / 1e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10020440 [exp] 107 / 4e-31 AT1G29430 72 / 3e-17 SAUR-like auxin-responsive protein family (.1) Lus10007060 [exp] 106 / 3e-30 AT1G29430 71 / 2e-16 SAUR-like auxin-responsive protein family (.1) Lus10020441 [exp] 102 / 3e-29 AT1G29430 71 / 4e-17 SAUR-like auxin-responsive protein family (.1) Lus10020432 [exp] 99 / 1e-27 AT1G20470 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10020430 [exp] 83 / 8e-22 AT1G29460 66 / 5e-15 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G043400 [exp] 69 / 6e-16 AT5G27780 141 / 8e-44 SAUR-like auxin-responsive protein family (.1) Potri.004G181400 [exp] 66 / 2e-14 AT1G29450 132 / 4e-40 SAUR-like auxin-responsive protein family (.1) Potri.009G141201 [exp] 64 / 6e-14 AT5G27780 132 / 3e-40 SAUR-like auxin-responsive protein family (.1) Potri.009G141251 [exp] 62 / 4e-13 AT1G29430 93 / 7e-25 SAUR-like auxin-responsive protein family (.1) Potri.002G064300 [exp] 62 / 6e-13 AT1G29510 109 / 2e-31 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G140900 [exp] 61 / 1e-12 AT1G29510 139 / 3e-43 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.017G043500 [exp] 60 / 2e-12 AT5G27780 120 / 1e-35 SAUR-like auxin-responsive protein family (.1) Potri.009G141150 [exp] 58 / 1e-11 AT1G29450 131 / 5e-40 SAUR-like auxin-responsive protein family (.1) Potri.005G196850 [exp] 58 / 5e-11 AT1G29510 102 / 2e-27 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.013G111000 [exp] 54 / 2e-10 AT4G09530 93 / 3e-26 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10020439 pacid=23139546 polypeptide=Lus10020439 locus=Lus10020439.g ID=Lus10020439.BGIv1.0 annot-version=v1.0 ATGAGAACTCTCGTAAGGCTCACGATGCGAAAATGGAGGCAAATTGAAGTAATGCGAAGAATGCGATTTGCTTCTTCTTCTTCTTCAACATCATCCCTTT GTTCTTGGAATAATGATAGCAAGGATGGTCATTTTGTGGTTTACAGTATGGACAAAAGCCGGTTTGTGATACCATTGAAGCTTCTGGAAAGTAGAATTAT AGTGGAACTACTGAAGATGTCAGAAGATGAGTTTGGATTCTCCAACGACACAATAGTGCTGCCATTTGAATCTTGTACCATGAACCAGATCATTAGGTTT CTCTCGTCCAGGCAACAAGGAGATGAATATCGTCACCAGCTTGAGCAAGGAGCTCACTTCAAACTTCTTGTGCACAACGTGTAA
AA sequence Show only first row Show all	>Lus10020439 pacid=23139546 polypeptide=Lus10020439 locus=Lus10020439.g ID=Lus10020439.BGIv1.0 annot-version=v1.0 MRTLVRLTMRKWRQIEVMRRMRFASSSSSTSSLCSWNNDSKDGHFVVYSMDKSRFVIPLKLLESRIIVELLKMSEDEFGFSNDTIVLPFESCTMNQIIRF LSSRQQGDEYRHQLEQGAHFKLLVHNV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G29510		SAUR68	SMALL AUXIN UPREGULATED 68, SA...		Lus10020439 [exp]	0	1
AT5G06060			NAD(P)-binding Rossmann-fold s...		Lus10040736 [exp]	4.7	0.9030
AT2G30695			unknown protein		Lus10008363 [exp]	5.6	0.9076
AT2G32180		PTAC18	plastid transcriptionally acti...		Lus10035307 [exp]	6.6	0.8878
AT5G02710			unknown protein		Lus10003988 [exp]	7.1	0.8777
AT1G72690			unknown protein		Lus10008389 [exp]	7.7	0.8714
AT5G16140			Peptidyl-tRNA hydrolase family...		Lus10031901 [exp]	8.5	0.8962
AT2G35450			catalytics;hydrolases (.1)		Lus10037047 [exp]	10.6	0.8710
AT4G30845			unknown protein		Lus10002320 [exp]	11.2	0.8680
AT2G38570			unknown protein		Lus10022733 [exp]	12.1	0.8622
AT1G02160			Cox19 family protein (CHCH mot...		Lus10032273 [exp]	15.1	0.8082

Compare expression of checked genes

Lus10020439 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.