Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G29430 67 / 4e-15 SAUR-like auxin-responsive protein family (.1) AT5G27780 66 / 9e-15 SAUR-like auxin-responsive protein family (.1) AT1G29490 65 / 9e-15 SAUR-like auxin-responsive protein family (.1) AT1G29420 65 / 2e-14 SAUR-like auxin-responsive protein family (.1) AT1G76190 65 / 2e-14 SAUR-like auxin-responsive protein family (.1) AT1G29510 65 / 2e-14 SAUR68 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) AT1G29440 64 / 4e-14 SAUR-like auxin-responsive protein family (.1) AT1G29460 62 / 2e-13 SAUR-like auxin-responsive protein family (.1) AT1G20470 61 / 6e-13 SAUR-like auxin-responsive protein family (.1) AT1G29500 59 / 5e-12 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007069 [exp] 172 / 5e-57 AT1G29430 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10007068 [exp] 167 / 4e-55 AT1G29510 68 / 1e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10007067 [exp] 163 / 2e-53 AT1G29430 69 / 4e-16 SAUR-like auxin-responsive protein family (.1) Lus10020441 [exp] 150 / 2e-48 AT1G29430 71 / 4e-17 SAUR-like auxin-responsive protein family (.1) Lus10020439 [exp] 105 / 3e-30 AT1G29510 67 / 5e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10007060 [exp] 103 / 2e-29 AT1G29430 71 / 2e-16 SAUR-like auxin-responsive protein family (.1) Lus10007066 [exp] 100 / 3e-28 AT1G29430 66 / 5e-15 SAUR-like auxin-responsive protein family (.1) Lus10020432 [exp] 99 / 7e-28 AT1G20470 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10020430 [exp] 78 / 1e-19 AT1G29460 66 / 5e-15 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G141251 [exp] 71 / 1e-16 AT1G29430 93 / 7e-25 SAUR-like auxin-responsive protein family (.1) Potri.017G043400 [exp] 69 / 6e-16 AT5G27780 141 / 8e-44 SAUR-like auxin-responsive protein family (.1) Potri.002G064300 [exp] 69 / 9e-16 AT1G29510 109 / 2e-31 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.004G181400 [exp] 69 / 1e-15 AT1G29450 132 / 4e-40 SAUR-like auxin-responsive protein family (.1) Potri.017G043500 [exp] 69 / 1e-15 AT5G27780 120 / 1e-35 SAUR-like auxin-responsive protein family (.1) Potri.009G141201 [exp] 66 / 8e-15 AT5G27780 132 / 3e-40 SAUR-like auxin-responsive protein family (.1) Potri.009G141150 [exp] 64 / 6e-14 AT1G29450 131 / 5e-40 SAUR-like auxin-responsive protein family (.1) Potri.005G196850 [exp] 65 / 9e-14 AT1G29510 102 / 2e-27 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G141100 [exp] 62 / 2e-13 AT1G29510 117 / 8e-35 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.013G111000 [exp] 59 / 9e-13 AT4G09530 93 / 3e-26 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10020440 pacid=23139587 polypeptide=Lus10020440 locus=Lus10020440.g ID=Lus10020440.BGIv1.0 annot-version=v1.0 ATGGCTCTTTCGAAAGCTCCGATGATGATCAGAAGAATGCGAATCGCTTCTTCTTCTTCGAATGTCGACAGCAAGGGTGGTCATTTCGTGGTTTACAGTA TGGATAATGTTCGGTTTGTGATACCGTTGACGTTTTTGAAGAGTAAAATCATTGTGGAATTGTTGAAGATGGCAGAAGATGAGTTTGGATTCTCAAGCGA GCAACCAATAGTGTTGCCATTTGAATCAAGTACCATGAATCAGATTATCATGCATCTCTCAACGTCCCGCCAGCAAGCGAAGGCGATGAATGAGAATACA AGCTTGAGCAACTACGTACAATCTCTTTCACAGTTTAACTATAGGACTGTAGGACTATGA
AA sequence Show only first row Show all	>Lus10020440 pacid=23139587 polypeptide=Lus10020440 locus=Lus10020440.g ID=Lus10020440.BGIv1.0 annot-version=v1.0 MALSKAPMMIRRMRIASSSSNVDSKGGHFVVYSMDNVRFVIPLTFLKSKIIVELLKMAEDEFGFSSEQPIVLPFESSTMNQIIMHLSTSRQQAKAMNENT SLSNYVQSLSQFNYRTVGL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G29430			SAUR-like auxin-responsive pro...		Lus10020440 [exp]	0	1
					Lus10002646 [exp]	3.0	0.7267
AT1G71680			Transmembrane amino acid trans...		Lus10008263 [exp]	7.5	0.7362
AT2G43820		SGT1, ATSAGT1, ...	UDP-glucose:salicylic acid glu...		Lus10024834 [exp]	10.2	0.7283
AT1G09080		BIP3	binding protein 3, Heat shock ...		Lus10010136 [exp]	13.0	0.6949
AT5G63810		BGAL10	beta-galactosidase 10 (.1)		Lus10023977 [exp]	15.4	0.7255
AT3G14250			RING/U-box superfamily protein...		Lus10026104 [exp]	15.9	0.6310
AT3G45600		TET3	tetraspanin3 (.1)		Lus10023218 [exp]	17.7	0.7235
					Lus10009372 [exp]	21.7	0.7013
AT4G29280		LCR22	low-molecular-weight cysteine-...		Lus10015983 [exp]	23.2	0.7013
AT1G23965			unknown protein		Lus10030641 [exp]	23.4	0.7031

Compare expression of checked genes

Lus10020440 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.